Abstract
The CRL4Cdt2 ubiquitin ligase complex is an essential regulator of cell-cycle progression and genome stability, ubiquitinating substrates such as p21, Set8 and Cdt1, via a display of substrate degrons on PCNA. Here, we examine the hierarchy of the ligase and substrate recruitment kinetics onto PCNA at sites of DNA replication. We demonstrate that the C-terminal end of Cdt2 bears a PCNA interaction protein motif (PIP box, Cdt2PIP), which is necessary and sufficient for binding of Cdt2 to PCNA. Cdt2PIP binds PCNA directly with high affinity, two orders of magnitude tighter than the PIP box of Cdt1. X-ray crystallographic structures of PCNA bound to Cdt2PIP and Cdt1PIP show that the peptides occupy all three binding sites of the trimeric PCNA ring. Mutating Cdt2PIP weakens the interaction with PCNA, rendering CRL4Cdt2 less effective in Cdt1 ubiquitination and leading to defects in Cdt1 degradation. The molecular mechanism we present suggests a new paradigm for bringing substrates to the CRL4-type ligase, where the substrate receptor and substrates bind to a common multivalent docking platform to enable subsequent ubiquitination.
Summary blurb The C-terminal end of Cdt2 contains a PIP-box for binding to PCNA to promote CRL4Cdt2 function, creating a new paradigm, where the substrate receptor and substrates bind to a common multivalent docking platform for ubiquitination.
INTRODUCTION
The integrity of genomic information is critical for proper cell function and cell survival, and is maintained by faithful replication during the S phase and segregation of duplicated chromosomes during mitosis. Cells are continuously challenged by genotoxic agents and environmental stress, and have complex mechanisms to activate DNA damage checkpoints, prevent cell-cycle progression, and repair the damaged DNA (Branzei and Foiani, 2010; Hoeijmakers, 2001). Many of the cell cycle transition events, as well as responses to DNA damage, are driven by E3 Cullin-RING ubiquitin Ligases (CRL), that catalyse the ubiquitination and destruction of specific protein targets. Such cell cycle regulated E3 ligases include CRL1Fbox and CRL4DCAF, which target many substrates crucial for cell cycle regulation and DNA damage responses (Cardozo and Pagano, 2004; Jackson and Xiong, 2009; Petroski and Deshaies, 2005). These CRLs comprise a scaffolding protein, cullin 1 or cullin 4 (Cul4), an adapter protein (Skp1 and DDB1 respectively), and a RING domain protein that interacts with the E2 (like Rbx1 or Rbx2). Finally, CRL1 and CRL4 ligases contain either an F-box or DCAF substrate recognition factor (SRF, or substrate receptor) respectively, responsible for interacting with the substrate and targeting it for ubiquitination. F-box proteins in CRL1, like Fbw7 or β-TRCP, recognize specific degrons in substrates that often contain phosphorylated residues, while CRL4 include DCAFs like DDB2, which directly recognizes UV-damaged DNA (Scrima et al., 2008).
The CRL4Cdt2 ligase uses Cdt2 as the substrate recognition factor, and functions both during S phase and after DNA damage (Abbas and Dutta, 2011; Havens and Walter, 2011; Sakaguchi et al., 2012; Stathopoulou et al., 2012). Cdt2, targets substrates like p21 and Set8, and the DNA replication licensing factor Cdt1 for ubiquitin-mediated proteolysis both in S phase and following DNA damage (Abbas et al., 2008; Centore et al., 2010; Jorgensen et al., 2011; Kim et al., 2008; Nishitani et al., 2008; Oda et al., 2010; Tardat et al., 2010). In addition, an increasing number of Cdt2 target proteins have been identified, including thymine DNA glycosylase (TDG), Cdc6, the DNA polymerase delta subunit p12 (Clijsters and Wolthuis, 2014; Shibata et al., 2014; Slenn et al., 2014; Terai et al., 2013) and Xeroderma pigmentosum group G (XPG), a structure-specific repair endonuclease of the Nucleotide Excision Repair pathway (NER)(Han et al., 2015).
Cdt1 and Cdt2 were originally identified as Cdc10 dependent transcript 1 and 2 in fission yeast, but have no sequence similarity (Hofmann and Beach, 1994). Cdt1 has a critical role in establishing the DNA replication licensing complex in G1 phase: it associates with chromatin through the origin recognition complex (ORC) and operates together with Cdc6 to load the MCM2-7 complex onto chromatin, thereby licensing DNA for replication (Bell and Dutta, 2002; Blow and Dutta, 2005; Diffley, 2004; Nishitani and Lygerou, 2004; Symeonidou et al., 2012; Tsakraklides and Bell, 2010).
Preventing re-licensing of replicated regions is essential (Arias and Walter, 2007; Blow and Dutta, 2005). One of the mechanisms to achieve this is by CRL1Skp2 and CRL4Cdt2 redundantly mediating Cdt1 destruction in higher organisms. CRL1Skp2 (also known as SCFSkp2) recognizes a phospho-degron motif on Cdt1 that is created at the initiation of S phase by cyclin dependent kinases (CDKs) (Li et al., 2003; Nishitani et al., 2006; Sugimoto et al., 2004). In contrast, CRL4Cdt2 recognizes Cdt1 when bound to the proliferating cell nuclear antigen (PCNA) trimer, through a binding motif (PIP box) in its N-terminal end (Arias and Walter, 2006; He et al., 2006; Higa et al., 2006; Jin et al., 2006; Kim and Kipreos, 2007; Nishitani et al., 2006; Ralph et al., 2006; Sansam et al., 2006; Senga et al., 2006). Both initiation of DNA replication and DNA damage trigger PCNA loading onto chromatin and Cdt1 association with PCNA through its PIP box (Arias and Walter, 2006; Havens and Walter, 2009; Raman et al., 2011; Shiomi et al., 2012b). DNA damage-induced degradation of Cdt1 and other substrates appears to facilitate repair (Mansilla et al., 2013; Tanaka et al., 2017; Tsanov et al., 2014)
Cdt2 recruitment onto chromatin is not fully characterized: recruitment through the Cdt1 PIP-box bound to PCNA and a specific basic residue downstream of the Cdt1 PIP box (Havens et al., 2012; Havens and Walter, 2009; Michishita et al., 2011) or independently of Cdt1 (Roukos et al., 2011) has been reported. Following CLR4Cdt2 mediated ubiquitination, Cdt1 is degraded, thus blocking further licensing. The N-terminal region of Cdt2 contains a WD40 repeat domain, predicted to form a substrate recognizing propeller structure similar to the one shown for DDB2 (Havens and Walter, 2011; Scrima et al., 2008). In analogy with DDB2 (Fischer et al., 2011), the N-terminal domain of Cdt2 should bind to the DDB1 WD40 repeat domains BPA and BPC on one side. The other side would be expected to recognize the substrate, in analogy to DDB2. Higher eukaryotic Cdt2 proteins have an extended C-terminal region, not present in fission yeast. In Xenopus the C-terminal domain of Cdt2 binds to PCNA and is important for the turnover of the Xic1 cyclin kinase inhibitor (Kim et al., 2010). Recently, we reported that Cdt2 mutated at multiple CDK consensus phosphorylation sites co-localized with PCNA throughout S phase even when most of the substrates were degraded, also suggesting that Cdt2 interacts with PCNA independent of its substrates (Nukina et al., 2018).
To understand how Cdt2 recognizes PCNA and localizes CRL4Cdt2 activity during S phase and following UV-irradiation, we investigated the role of Cdt2 domains in localization and ubiquitination. Unexpectedly, we found a PIP box in the C-terminal end of Cdt2, and showed that it directly mediates interaction of Cdt2 with PCNA. Both Cdt1 and Cdt2 PIP box peptides bind the PCNA binding pocket in a similar manner, but Cdt2 has significantly higher affinity for PCNA. We suggest that Cdt2 and Cdt1 could simultaneously recognize different subunits of the PCNA trimer, and we put forward a new paradigm for localizing E3 ligase activity onto the PCNA docking platform, allowing simultaneous docking of substrates in the same platform, enabling ubiquitination by proximity.
RESULTS
Cdt2 is stably bound to UV-damaged sites independently of Cdt1
CRL4Cdt2 recognizes Cdt1 bound on PCNA and recruitment of CRL4Cdt2 to damaged chromatin was reported to require Cdt1 in Xenopus extracts(Havens and Walter, 2009). In contrast, experiments in live human cells suggested that Cdt2 was recruited to DNA damage sites independently of Cdt1 (Roukos et al., 2011). To verify whether Cdt2 binding to damaged sites requires Cdt1, we performed a time course analysis of Cdt2 recruitment to sites of localized UV-C irradiation in control and Cdt1 depleted HeLa cells. Cells were exposed to UV-C through micropore filters, and locally induced damage was detected by staining of Cyclopyrimidine dimers (CPDs). In control cells, Cdt1 was rapidly recruited to damaged sites (Fig 1A, 10 minutes) and proteolysed by 30 minutes (fig. 1A and B), consistent with earlier studies (Ishii et al., 2010; Roukos et al., 2011). Cdt2 was recruited at sites of damage by 10 minutes while cells showing Cdt2 recruitment increased at subsequent time points (30 and 45 minutes post-irradiation) even-though Cdt1 was degraded. Depletion of Cdt1 by siRNA had no effect on either the kinetics or the extent of Cdt2 recruitment to sites of UV-C damage (Fig. 1A and 1B). These results show that Cdt2 is recruited to UV-C irradiated sites independently of Cdt1 and remains there long after Cdt1 proteolysis.
To assess the binding properties of Cdt2 at sites of UV-C damage in the presence and absence of Cdt1, Fluorescence Recovery after Photobleaching (FRAP) was employed. MCF7 cells transiently expressing Cdt1, Cdt2 or PCNA tagged with GFP were first analysed in the presence and absence of local UV-C irradiation (Fig 1C and Supplementary Fig S1A-C). All factors exhibit fast recovery in the absence of damage (Fig S1A, C), consistent with transient interactions (Xouri et al, 2007b). Following recruitment to sites of damage, PCNA shows a significant immobile fraction, as expected for stable binding, while Cdt1 shows dynamic interactions at UV-C damaged sites (Rapsomaniki et al., 2015; Roukos et al., 2011). Cdt2 has a slower fluorescence recovery rate at the site of damage than Cdt1, with a half-recovery time of 0.83 seconds and an immobile fraction of 16%, underlining long-term association at UV-C damage sites. To assess whether Cdt2 binding to sites of damage is affected by the presence of Cdt1, Cdt2 kinetics were assessed by FRAP in MCF7 cells synchronized in G1, depleted of Cdt1 and locally UV-C irradiated. As shown in Fig 1D and in Supplementary Fig 1D and E, the binding kinetics of Cdt2 at the sites of damage remain the same despite the absence of Cdt1.
We conclude that Cdt2 binds to sites of damage stably independently of Cdt1.
The C-terminal part of Cdt2 is required for recruitment to DNA damage sites
The above results suggested that Cdt2 contains a domain that mediates its association with UV damaged sites independently of Cdt1. Human Cdt2 is a 730 amino acid polypeptide, with an N-terminal WD40 domain predicted to form a substrate receptor and a long C-terminal domain (Figure 2A). Constructs expressing Cdt21-417, which contains the N-terminal WD40 domain; the C-terminal Cdt2390-730; and the full length Cdt21-730 as a control fused with GFP were transiently expressed in MCF7 cells, followed by localised UV-C irradiation (Figure 2). Cdt21-730 was robustly detected at DNA damage sites, as previously reported. The C-terminal Cdt2390-730 construct was also efficiently recruited to DNA damage sites. On the contrary, there was no evidence for recruitment of Cdt21-417 to sites of damage. This suggests that the C-terminal region of Cdt2, but not the predicted N-terminal substrate receptor domain, is important for its recruitment to sites of damage.
The C-terminal part of Cdt2 is required for interaction with PCNA and has a PIP box in its C-terminal end
Consistent with the observation that the C-terminal region of Cdt2 is important for recruitment to the CPD stained sites where PCNA also localizes, we identified PCNA as a Cdt2 C-terminus interacting protein in a yeast two hybrid screening (Supplementary Fig.S2). To confirm the interaction with PCNA, we transiently transfected 3FLAG-tagged Cdt21-730, Cdt21-417 and Cdt2390-730 into HEK293T cells. Before cell lysate preparation, cells were cross-linked. Immuno-precipitation (IP) experiments using α-FLAG antibody showed that the C-terminal half, but not the N-terminal half, interacts with PCNA (Figure 3A). The Cdt21-417 domain, while it lost most of its affinity for PCNA, is still able to bind DDB1 as expected. In contrast, the Cdt2390-730 domain, while it still binds to PCNA, has lost its ability to bind DDB1 and therefore to form a functional CRL4 complex.
To narrow the region of Cdt2 required for interaction with PCNA, we made a series of additional constructs fused to a triple FLAG tag. We confirmed that when the C-terminal 30 amino acids were deleted in the Cdt21-700 construct, this was sufficient to lead to loss of interaction with PCNA (Figure 3B). Consistently, the C-terminal 130 amino acids alone, Cdt2600-730, were sufficient to mediate the interaction with PCNA.
We postulated that the C-terminal part of Cdt2 directly interacts with PCNA via a PCNA interaction protein (PIP) box; a common motif found in PCNA-dependent DNA replication and repair factors. We used PROSITE to search the UniProtKB protein sequence database for human sequences that contained consensus PIP-boxes ([KMQ]-x-x-[ILMV]-x-x-[FY]-[FY]). Our search revealed a PIP-box sequence from amino acids 706 to 713 in the C-terminus of Cdt2. This motif was well conserved in vertebrates and in Drosophila (Figure 3C). We then generated a triple-mutant where the three conserved hydrophobic residues I709, Y712 and F713, also known to interact with PCNA in structures of PIP-box proteins bound to PCNA, were all mutated to alanine, yielding Cdt2PIP-3A.
Introducing the Cdt2PIP-3A construct fused to a C-terminal FLAG tag to cells and subsequent IP experiments with anti-FLAG antibody after cross linking, showed that the interaction of the Cdt2PIP-3A construct with PCNA was lost almost entirely (Fig. 3D, UV -), without significantly affecting interaction with Cul4A and DDB1. To confirm the interaction, we performed the reverse IP experiment. Myc-tagged PCNA was co-transfected with Cdt2WT or Cdt2PIP-3A and we performed an IP with anti-myc antibody. Cdt2WT was co-precipitated with myc-PCNA, but Cdt2PIP-3A was not detected in the precipitates (Fig. 3E).
Next, we examined the interaction of CRL4Cdt2 ligase with its target protein Cdt1, using HEK293 cells alone and cells transfected with Cdt2WT or Cdt2PIP-3A, with or without UV irradiation. Using an anti-FLAG antibody resin to precipitate Cdt2WT, both PCNA and Cdt1 were precipitated, and their amounts were notably increased after UV-irradiation (Figure 3D). In contrast, neither Cdt1 nor PCNA co-precipitated well with Cdt2PIP-3A, before or after UV irradiation. These results suggested that the PIP-box of Cdt2 was required for forming a stable complex with its substrates on PCNA.
A C-terminal PIP-box in Cdt2 directly interacts with PCNA with high affinity
To confirm that this PIP box motif in Cdt2 interacts directly with PCNA and to quantify that interaction, we synthesized the peptide corresponding to the human Cdt2 PIP-box (704-717) (SSMRKICTYFHRKS) with a carboxytetramethylrhodamine fluorescent label at the N-terminus (Cdt2PIP) and characterized its binding to recombinant PCNA, by fluorescence polarization (FP). Cdt2PIP binds PCNA with high affinity (57±3 nM, Figure 4A). The corresponding Cdt2PIP-3A peptide showed practically no detectable binding to PCNA in the same assay (Figure 4A), suggesting that the Cdt2 PIP-box binds PCNA in a manner very similar to other known PCNA complexes with PIP-box peptides.
As Cdt1 is recruited to PCNA on chromatin during S phase and after DNA damage through the Cdt1 N-terminal PIP-box (residues 3-10) (Havens and Walter, 2009; Ishii et al., 2010; Roukos et al., 2011), we then synthesized a Cdt1PIP-TAMRA (MEQRRVTDFFARRR) peptide, to compare its affinity to PCNA. Remarkably, the affinity of the Cdt1PIP peptide to PCNA (7200 ± 200 nM, Figure 4A) is two orders of magnitude weaker than that for the Cdt2PIP, and similar to what is reported for other peptides derived, for example, from the pol-δ p66 and FEN1 (1-60 µM), (Bruning and Shamoo, 2004). The affinity of the Cdt2PIP peptide for PCNA is similar to that reported for the tightly binding p21 PIP box peptide (50-85 nM) (Bruning and Shamoo, 2004; De Biasio et al., 2012), as it was confirmed in our assays (RRQTSMTDFYHSKR, 36±2 nM, Figure 4A).
To confirm the binding mode of the Cdt2PIP and Cdt1PIP peptides to PCNA, we determined the crystal structure of both complexes by X-ray crystallography, to 3.5 and 3.4 Å resolution respectively. PCNA adopts its well-characterized trimer conformation, with one peptide bound per monomer. The binding mode of both the peptides was very clear (Figure 4B,C, and Suppl. Figure S3A,B, Table 1, and Materials and Methods for details). Both peptides bind similar to other PCNA complex structures. Some notable differences in the binding mode are the conserved Phe713/Phe11 side chain ring that rotates 180 degrees between the two structures and the Tyr712/Phe10 that repositions so as to extend more towards a hydrophilic environment in Cdt2. The Ile709 and Val7 side chains occupy a similar space in the hydrophobic recognition pocket. Albeit the peptide main chain is in a very similar conformation between the structures, some of the other side chains adopt rather different conformations. The average buried area upon the binding of the Cdt2 peptide is 692±6 Å2 and average calculated energy of binding is −13±0.2 kcal mol-1 while the average buried area upon the binding of the Cdt1 peptide is 650±4 Å2 and average calculated energy of binding is −8.3±0.5 kcal mol-1; these confirm the tighter binding of the Cdt2 peptide to PCNA.
Cdt2 directly binds to PCNA on DNA through its PIP box independently of Cdt1 in vitro
The above results suggested that Cdt2 was recruited to PCNA sites primarily through its PIP-box rather than the N-terminal substrate receptor domain, which contrasts to the model that Cdt1 and CRL4Cdt2 are sequentially recruited to PCNAon Chromatin. To investigate the mechanism of Cdt1 and CRL4Cdt2 recruitment to PCNA, we set up an in vitro analysis with purified and defined human proteins. FLAG tagged Cdt1(Cdt1-3FLAG) and CRL4Cdt2 (Cdt2-3FLAG) were expressed in insect cells and purified on anti-FLAG resin (Figure 5A). PCNA and its loader RFC were purified as described in the Experimental procedures (Supplementary Figure S4). First, we examined the interaction of Cdt1 or CRL4Cdt2 with PCNA in the absence of DNA (free PCNA). The purified Cdt1 or CRL4Cdt2 were fixed on anti-FLAG beads, incubated with free PCNA, and the amount of bound PCNA was analyzed. In contrast to the above mentioned results that both Cdt1 and Cdt2 PIP-box peptides bound to PCNA (Figure 4), PCNA was detected on Cdt1-beads, but much less on CRL4Cdt2-beads (Figure 5B).
Because Cdt1 and Cdt2 bind to PCNA only when PCNA is loaded on DNA in Xenopus egg extracts (Havens and Walter, 2009), we prepared PCNA loaded on nicked circular DNA (ncDNA) with RFC (PCNAon DNA) (Supplementary Figure S5). In our in vitro conditions, three molecules of PCNA trimer were loaded on one plasmid DNA. Then, we analyzed the binding of Cdt1 and CRL4Cdt2 to PCNAon DNA as described in Supplementary Figure S5A. After incubation, Cdt1 was efficiently recovered on the PCNAon DNA -beads, but not on the control beads (Figure 5C). Although we could not show CRL4Cdt2 binding to free PCNA, we show that CRL4Cdt2 binds to PCNAon DNA in the absence of Cdt1. The interaction was not mediated by RFC proteins bound on ncDNA (Figure 5D lane 6). The molar ratio of Cdt2 bound to trimeric PCNAon DNA was the same or somewhat higher than that of Cdt1 (406 fmol of Cdt2 bound to 158 fmol trimeric PCNAon DNA, while 301 fmol of Cdt1 to 148 fmol of trimeric PCNAon DNA). These results indicate that CRL4Cdt2 directly and efficiently binds to DNA-loaded PCNA without substrate, consistent with data in cells showing that Cdt2 was recruited to sites of damage in the absence of Cdt1 (Figure 1).
To confirm that the interaction of CRL4Cdt2 with PCNAon DNA was mediated by the PIP-box of Cdt2, the CRL4 complex having Cdt2PIP-3A (CRL4Cdt2(PIP-3A)) was purified like CRL4Cdt2 (Figure 5A) and used in a binding assay. As above, CRL4Cdt2 interacted with PCNAon DNA. In contrast, the binding activity of CRL4Cdt2(PIP-3A) to PCNAon DNA was severely reduced as compared with CRL4Cdt2 (Figure 5D). These results demonstrate that the PIP-box of Cdt2 was directly responsible for the interaction of CRL4Cdt2 with PCNAon DNA.
The Cdt2 PIP-box promotes Cdt2 recruitment to UV irradiated sites and PCNA foci
To investigate the role of the Cdt2 PIP-box in cells we isolated HEK293 cells stably expressing FLAG tagged Cdt2PIP-3A and showed that Cdt2PIP-3A was not recruited to UV-irradiated sites (Figure 6A). XPA, a component of nucleotide excision repair, staining was used to confirm that similar extents of DNA damage were induced both in Cdt2WT and Cdt2PIP-3A expressing cells. Next, we verified that the recruitment of Cdt2 onto PCNA during S phase is also dependent on its PIP-box. In order to detect the chromatin-associated fraction of PCNA and Cdt2, asynchronous cells were pre-extracted prior fixation and co-stained with PCNA and FLAG antibodies. A similar percentage of PCNA-positive S phase cells was detected both in Cdt21-730/WT expressing cells and Cdt2PIP-3A expressing cells (Supplementary Figure S6). Cdt2WT was co-localized with PCNA foci, corresponding to sites of DNA replication. More than 80% of PCNA-positive cells were co-stained with Cdt2WT, with the early S phase cells displaying stronger Cdt2WT staining than the late S phase cells as reported (Nukina et al., 2018) (Figure 6B and 6C and Supplementary Figure S6A). In contrast, almost no signal was detected for Cdt2PIP-3A irrespective of the presence of PCNA. Consistent with the immunofluorescence analysis, following cell fractionation, Cdt2WT was recovered in a chromatin-containing fraction, while Cdt2PIP-3A was undetectable (Figure 6D).
These results collectively suggest that while Cdt2PIP-3A is capable of forming a complex with the rest of the components of the CRL4 ligase, the Cdt2 PIP-box is required for efficient recruitment of CRL4Cdt2 to the PCNA-loaded sites.
Cdt1 ubiquitination is abortive in Cdt2PIP-3A expressing cells
Since the recruitment of Cdt2PIP-3A to PCNA sites was compromised, it would imply that ubiquitination of Cdt1 was also abrogated. To consider this possibility, asynchronously growing control HEK293 cells and cells expressing Cdt2WT or Cdt2PIP-3A were treated with proteasome inhibitor MG132 and the levels of poly-ubiquitinated Cdt1 were examined. While poly-ubiquitinated Cdt1 was clearly detected in Cdt2WT expressing cells, its levels were reduced in Cdt2PIP-3A expressing cells (Figure 6E), indicating that the ability of Cdt2PIP-3A to ubiquitinate Cdt1 was compromised. Fractionation of cell extracts revealed that most of the poly-ubiquitinated Cdt1 and p21 were recovered in the chromatin-containing precipitate fraction prepared from Cdt2WT expressing cells, in agreement with CRL4Cdt2 operating on chromatin (Figure 6E). Cdt2PIP-3A expressing cells however had reduced level of both poly-ubiquitinated Cdt1 and p21 on chromatin. Interestingly, Cdt2 itself is poly-ubiquitinated on chromatin, and this is severely reduced in Cdt2PIP-3A expressing cells (Figure 6E). Increased levels of poly-ubiquitination of Cdt1 and p21 were also observed in another cell line, U2OS cells expressing Cdt2WT, but not in cells expressing Cdt2PIP-3A (Supplementary Figure S7B).
Next, we examined the accumulation of poly-ubiquitinated Cdt1 after UV-irradiation. For this experiment, the endogenous Cdt2 was depleted with an siRNA targeted to the 3’ UTR to assay for the activity of introduced Cdt2. Cells were treated with MG132, irradiated with UV and the levels of poly-ubiquitinated Cdt1 were monitored by Western blotting. In HEK293 cells treated with control siRNA, poly-ubiquitinated Cdt1 was detected 15 min after irradiation (Supplementary Figure S6B). Depletion of Cdt2 blocked the poly-ubiquitination of Cdt1. The defect was rescued by Cdt2WT expression. In contrast, Cdt2PIP-3A expressing cells were defective in poly-ubiquitination of Cdt1 (Supplementary Figure S6B), suggesting that Cdt2 PIP-box is required for efficient poly-ubiquitination of substrates.
The Cdt2 PIP-box is required for efficient Cdt1 degradation
Since the poly-ubiquitination activity of Cdt2PIP-3A was reduced, we monitored the degradation of Cdt1 after UV irradiation. Asynchronously growing control U2OS cells and cells expressing Cdt2WT or Cdt2PIP-3A (Supplementary Figure S7) were depleted of endogenous Cdt2 using an siRNA targeted to the 3’ UTR, and irradiated with UV. When cells were exposed to UV (20 J/m2), degradation of Cdt1 was almost prevented in U2OS cell depleted of endogenous Cdt2 (Figure 7A and 7B). Ectopic expression of Cdt2WT restored Cdt1 degradation to similar kinetics to that of control siRNA transfected U2OS cells. In contrast, Cdt2PIP-3A was much less effective in rescuing Cdt2 depletion. Similarly, at a lower dose of UV-irradiation (5 J/m2), Cdt1 remained stable 1 hr post UV-irradiation in Cdt2PIP-3A cells, when endogenous Cdt2 was depleted, both on immunofluorescent analyses and Western blotting (Figure 7C and Supplementary Figure S7C).
Next, we examined Cdt1 degradation after the onset of S phase in the Cdt2PIP-3A expressing cells. Cyclin A is present in S and G2 phase, when Cdt1 should be degraded. Thus, Cdt1 should be present in cells that are negative for Cyclin A, and absent in cells that are positive for Cyclin A (Nishitani et al., 2006; Xouri et al., 2007a; Xouri et al., 2007b). Cdt1 degradation after the onset of S phase is carried out by two ubiquitin ligases, CRL1Skp2 and CRL4Cdt2. We depleted the substrate recognition subunits, Cdt2 and/or Skp2, by siRNA, and the percentage of Cdt1 positive cells among Cyclin A-positive cells, was assessed by immunofluorescence. In control siRNA transfected U2OS cells, ~2% of Cyclin A positive cells stained positive for Cdt1. In contrast, in Cdt2 depleted, Skp2 depleted and Cdt2/Skp2 co-depleted cells, 50%, 30% and more than 80% of Cyclin A positive cells stained positive for Cdt1 respectively (Figure 8A-8C), consistent with earlier work (Nishitani et al., 2006). Then, we depleted Cdt2 and Skp2 and examined Cdt1 degradation in Cdt2WT or Cdt2PIP-3A expressing cells. Ectopic expression of Cdt2WT fully complemented the depletion of Cdt2, and also the co-depletion of Skp2. This was probably because the levels of ectopically expressed Cdt2WT were higher than the endogenous Cdt2 levels. On the other hand, Cdt1 degradation was not fully rescued by the expression of Cdt2PIP-3A protein both in Cdt2 depleted and Cdt2 and Skp2 co-depleted cells (Figure 8A and 8B). Upon depletion of endogenous Cdt2, many cells exhibited significantly enlarged nuclei, consistent with rereplication. This phenotype was rescued by ectopic expression of Cdt2WT but not of Cdt2PIP-3A (Fig.8D and Supplementary Fig.S8), suggesting that the PIP-box of Cdt2 is essential to prevent rereplication.
Taken together, our in vitro and in vivo analyses show that the Cdt2 PIP-box brings CRL4 ubiquitin ligase to PCNA sites and is required for efficient substrate degradation both during S phase and following UV irradiation, to maintain genome stability.
DISCUSSION
Cdt2 substrates are degraded rapidly as cells enter S phase or when cells are exposed to DNA damaging agents. Cdt2 of higher eukaryotic cells has an extended C-terminal region. We demonstrate that Cdt2 has a PIP box in its C-terminal end that recognises chromatin bound PCNA with high affinity. This interaction is important for CRL4Cdt2 function in recognising its targets prior to their ubiquitin-dependent degradation: this previously un-noticed Cdt2 PIP-box is required for recruitment of CRL4Cdt2 to chromatin bound PCNA, and indispensable for efficient Cdt1 ubiquitination, thus for prompt degradation of Cdt1 both in S phase and after UV irradiation. The Cdt2 PIP-box peptide directly interacts with PCNA with high affinity (about 50 nM) in vitro, similar to the unusually high-affinity p21 PIP box peptide, and significantly tighter than the Cdt1 PIP-box peptide. Molecular modelling experiments suggest that both the Cdt1 and Cdt2 PIP-boxes bind PCNA in the classical way and their binding to PCNA occurs independently of each other (Figure 4). Furthermore, the purified CRL4Cdt2 ligase interacted directly to the PCNA loaded on DNA via Cdt2 PIP-box (Figure 5). Consistently, the C-terminal domain of Cdt2 has been shown to bind to PCNA in Xenopus egg extracts (Kim et al., 2010). Our analysis now shows that the PIP-box is conserved in Xenopus, and thus likely to be responsible for this interaction.
PCNA is a trimer, hence it offers three PIP-box binding sites that are proposed to be asymmetric when PCNA is loaded onto DNA (Ivanov et al., 2006). Consequently, both Cdt1 and Cdt2 can be simultaneously recruited onto PCNA, effectively utilizing PCNA as a common docking platform for bringing the CRL4Cdt2 ligase and the Cdt1 substrate in proximity, allowing more efficient transfer of a ubiquitin moiety from the E2 to Cdt1 (Figure 9). This Cdt2 PIP-box assisted ubiquitination is likely to be used by other Cdt2 substrates, as p21 poly-ubiquitination was also defective in Cdt2PIP-3A expressing cells (Figure 6E and Supplementary Figure S7B). This mechanism, where co-localization onto the same protein platform brings the E3 ubiquitin ligase and its substrate in proximity, is a new paradigm in ubiquitin conjugation. This model fits recent results which show that Cdt2 itself can be auto-ubiquitinated by CRL4Cdt2 (Abbas et al., 2013): CRL4Cdt2 and Cdt2 (or a second CRL4Cdt2) may both bind PCNA through the Cdt2 PIP-box and catalyse this auto-ubiquitination event. Consistently, the poly-ubiquitination of Cdt2 which was observed on chromatin in Cdt2WT expressing HEK293 cells was severely reduced in Cdt2PIP-3A expressing cells (Figure 6E).
The mono-ubiquitination (mUb) of PCNA is carried out by Rad6-Rad18, but also CRL4Cdt2 contributes to it. In non-damaged cells, mUb of PCNA is present at a basal level and its levels increase in response to DNA damage (Terai, et al). The Cdt2 PIP-box may also be important for mUb of PCNA, as mUb-PCNA levels appeared decreased in Cdt2PIP-3A in comparison to Cdt2wt expressing cells (Supplementary Figures S7B). Therefore, Cdt2 PIP-box may be required for various events driven by CRL4Cdt2 in the cell; degradation of PIP-degron proteins, auto-ubiquitination of Cdt2 and PCNA mono-ubiquitination.
We show that the Cdt2 PIP-box is crucial for recruitment of the CRL4Cdt2 ligase onto PCNA in human cells. However, further interactions of Cdt2 domains, mediated by its N-terminal WD40 repeats, with the PCNA-bound Cdt1 PIP-box (the PIP degron) also enhance the affinity of the CRL4Cdt2 (Havens and Walter, 2009). Here, we propose a synergistic mechanism where the Cdt2 PIP-box and the Cdt1 PIP-degron operate in concert to promote CRL4Cdt2-dependent target ubiquitination (Figure 9). It is also noteworthy that the binding of Cdt1 onto PCNA is transient in cells, while Cdt2 interactions are more stable (Roukos et al., 2011 and Figure 1B): a synergistic mechanism would imply that interactions of pre-bound Cdt2 with transiently formed Cdt1 PIP-degron, are important for localising CRL4Cdt2 and Cdt1 onto PCNA.
Although the Cdt2 PIP-box mediates direct interaction with PCNAon DNA, the affinity of Cdt2 to PCNA decreases as cells progress into and complete S phase. The chromatin levels of Cdt2 are reduced during late S phase (Rizzardi et al., 2015), and the co-localization of Cdt2WT with PCNA was mostly observed in early S phase cell nuclei (Figure 6B). It was suggested that the CDK-dependent phosphorylation of Cdt2 down-regulates Cdt2 interaction with PCNA, as Cdk1 inhibition recovered the chromatin-interaction of Cdt2 at late S phase, and Cdt2 mutated at CDK phosphorylation sites displayed strong interaction with PCNA throughout S phase (Nukina et al., 2018). We propose that the C-terminal region of Cdt2 contributes to regulating the activity of CRL4Cdt2 in the cell cycle by controlling its affinity to PCNA; Cdt2 PIP-box mediated binding to PCNA is important for rapid substrate degradation at the onset of S phase, while the phosphorylation of the C-terminal region of Cdt2 inhibits its PCNA interaction and thus reduces ubiquitination activity during late S phase, leading to substrate re-accumulation. It remains, however, to be elucidated how phosphorylation of Cdt2 inhibits its interaction to PCNA.
CRL-type ligases are thought to use the ‘substrate recognition factor’ or ‘substrate receptor’ subunit to recognize a specific degron in the substrate itself. However, CRL4-type ligases can deviate from that mechanism. For example, CRL4DDB2 recognizes specific UV-damaged bases in DNA, creating a ‘ubiquitination zone’ around the repair site, to ubiquitinate specific substrates (Fischer et al., 2011). Here we show a novel specific mechanism, where ligase and substrate recognize the same molecule of a cellular platform, to bring enzyme and substrate into close proximity and thus to facilitate substrate trapping: our data constitute a new paradigm for the use of a docking platform in ubiquitin conjugation. Creating such a three-component system offers many possibilities for regulation and robustness of the ubiquitination response: the recognition of PCNA by both substrate and Cdt2 through specialized PIP boxes likely enables further interactions between substrate and Cdt2 (as for example the recognition of the PIP degron by its N-terminal WD40 repeat domain), creating a set of redundant molecular recognition events that regulate this system in the cellular context.
EXPERIMENTAL PROCEDURES
Cell Culture
HeLa cells, HEK293 cells, 293T cells and U2OS cells were cultured in Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum and 5% CO2. MCF7 cells were cultured in Dulbecco’s modified Eagle’s medium with 20% fetal bovine serum and 5% CO2 at 37°C. HEK293 cells and U2OS cells stably expressing Cdt2WT(1-730)-3FLAG, Cdt21-417-3FLAG, FLAG-Cdt2300-730 or Cdt2PIP-3A-FLAG were isolated using plasmids pCMV-HA-Cdt2WT(1-730)-3FLAG, pCMV-HA-Cdt21-417-3FLAG, p3FLAG-Cdt2300-730-3NLS-myc or pCMV-HA-Cdt2PIP-3A-3FLAG. Proteasome inhibitor MG132 was used at 25 μM. UV-C (254 nm) irradiation of whole cells in dishes was performed at 5 to 100 J/m2 using a UV lamp (SUV-16, As One, Japan), a UV cross-linker (FS-800, Funakoshi) or a UV-box equipped with a UV-C lamp and a radiometer 254nm.
Plasmids
Cdt2WT(1-730)-3FLAG expression plasmid, pCMV-HA-Cdt2WT(1-730)-3FLAG was constructed by cloning the PCR-amplified HA-Cdt2WT(1-730) fragment into NcoI-NotI-cut pCMV-3FLAG. Cdt21-417-3FLAG expression plasmid, pCMV-HA-Cdt21-417-3FLAG and Cdt21-700-3FLAG was constructed in a same way by PCR-amplifying the corresponding region. FLAG-Cdt2300-730, Cdt2390-730, and Cdt2360-730 expressing plasmids were constructed by PCR-amplifying the corresponding regions, (300-730, 390-730, and 600-730) and cloning into the p3FLAG-3NLS-myc plasmid which was prepared by cutting out the p21 gene from the p3FLAG-3NLS-myc-p21 plasmid (Nishitani et al., 2008). pcDNA-6myc-PCNA was constructed by ligating the PCR-amplified 6myc and PCNA. To construct the expression plasmid of PIP box mutant of Cdt2 (Cdt2PIP-3A-FLAG), pCMV-HA-Cdt2PIP-3A-3FLAG, Quick Change site-directed mutagenesis method (Strategene) was performed using primers: AGCTCCATGAGGAAAGCCTGCACAGCCGCCCATAGAAAGTCCCAGGAG and CTGGGACTTTCTATGGGCGGCTGTGCAGGCTTTCCTCATGGAGCTGGG. The baculovirus expression plasmids for HA-Cul4A and His-myc-Rbx1 were as described. The pBP8- Cdt2WT(1-730)-3FLAG plasmid was constructed by ligating the BamH1-Cdt2-Kpn1 fragment from pBP8-Cdt2 and the Kpn1-Cdt2-3FLAG-Sma1 fragment from pCMV-HA-Cdt2-3FLAG into pBacPAK8 between BamH1 and Sma1 sites. pBP9-DDB1 was constructed by ligating the PCR-amplified BamH1-DDB1-EcoR1 fragment and the EcoR1-DDB1-Xho1 fragment into pBacPAK9 at BamH1-Xho1 sites. pBP9-Cdt1-3FLAG was constructed by cloning the PCR amplified Sac1-Cdt1-3FLAG-Xho1 fragment using pCMV-Cdt1-3FLAG as a template into pBacPAK9. The GFP-Cdt2wt, GFP-Cdt2(1-417) and GFP-Cdt2(390-730) expression plasmids were constructed by subcloning of the respective FLAG-tagged constructs into pEGFP-C3 (Clontech). For the GFP-Cdt2wt expression plasmid, pCMV-HA-Cdt2WT(1-730)-3FLAG was cut with NcoI and KpnI, KpnI and XmaI. In order to produce blunt ends for the NcoI sites, Klenow was used. The fragment was then cloned into the HindIII and XmaI sites of pEGFP-C3. The ends produced by HindIII were made blunt by Klenow. For the GFP-Cdt2(1-417) the pCMV-HA-Cdt21-417-3FLAG construct was cut by NcoI and XmaI. Klenow was used for the NcoI ends. The fragment was then cloned into the HindIII and XmaI sites of pEGFP-C3. The ends produced by HindIII were made blunt by Klenow. In order to achieve a better nuclear localization for the GFP-Cdt2wt and GFP-Cdt2(1-417) constructs these were sublconed into p3FLAG-3NLS-myc by XhoI and BamHI. Then they were subcloned again into pEGFP-C3 by using the HindIII-BamHI sites. For the GFP-Cdt2(390-730) expression plasmid, the p3FLAG-3NLS-myc Cdt2(390-730) construct was cut with HindIII and BamHI. The fragment produced was cloned into the HindIII-BamHI sites of pEGFP-C3.
Antibodies, Western Blotting, and Immunofluorescence
For Western blotting, whole cell lysates were prepared by lysing cell pellets directly in SDS-PAGE buffer. For immunofluorescence, U2OS or HEK293 cells were fixed in 4% paraformaldehyde (WAKO) for 10 min, permeabilized in 0.25% (v/v) Triton X-100 in phosphate-buffered saline (PBS), and stained with the indicated antibodies as described previously. For double-staining with PCNA and Cdt2WT or Cdt2PIP-3A, cells were permeabilized in 0.1% Triton X-100 for 1 min on ice, and were fixed in 4% paraformaldehyde (WAKO) for 10 min at room temperature, followed by fixation in ice-cold methanol for 10 min. For cyclobutane pyrimidine dimer (CPDs) staining, MCF7 and HeLa cells were fixed in 4% PFA for 10 minutes, permeabilized in 0.3% Triton X-100 in PBS and then incubated in 0.5 N NaOH for 5 min for DNA denaturation prior to immunofluorescence. Alexa 488-conjugated anti-mouse and Alexa592- conjugated anti-rabbit antibodies were used as secondary antibodies with Hoechst 33258 to visualize DNA. The following primary antibodies were used: Cdt1 (Nishitani et al., 2006), Cdt2 (Nishitani et al., 2008), cyclin A (mouse, Ab-6, Neomarkers; rabbit, H-432, Santa Cruz), Myc (mouse, 9E10, Santa Cruz), FLAG (F3165, F7425, SIGMA), PCNA (PC10, Santa Cruz; rabbit serum, a gift from Dr. Tsurimoto), XP-A (FL-273, Santa Cruz), RCC1(Shiomi et al., 2012a), DDB1(Bethyl Laboratories), Rbx1(ROC1, Ab-1, Neo Markers) and Cul4A (Bethyl Laboratories), DDB1 (Bethyl Laboratories), RFC1 (H-300, Santa Cruz Biotechnology), RFC4 (H-183, Santa Cruz Biotechnology) and DYKDDDDK Tag (Cell Signaling). CPDs(CosmoBio). Protein levels were analyzed by ImageJ software.
Micropore UV-irradiation assay
We used a method to induce DNA photoproducts within localized areas of the cell nucleus as described in Ishii et al. To perform micropore UV-irradiation, cells were cultured on cover slips, washed twice with PBS and subsequently covered with an isopore polycarbonate membrane filter (Millipore) with a pore size of either 3 or 5 μm in diameter, and irradiated. UV-irradiation was achieved using a UV lamp (SUV-16, As One, Japan) with a dose rate of 0.4 J/m2•s, which was monitored with a UV radiometer (UVX Radiometer, UVP) at 254 μm, or with a UV box equipped with a UV-C lamp monitored with a VLX-3W radiometer (Vilber Lourmat) at 254 nm (CX-254 sensor). The filter was removed and cells were either fixed or cultured for the indicated time before fixation, and processed for immunofluorescence. For FRAP analysis, cells were cultured for 20 minutes to allow recruitment to sites of damage prior to photobleaching.
Immunoprecipitation from Cdt2-FLAG expressing cells
Control or Cdt2-FLAG expressing 293 cells that were UV-irradiated (50 J/m2), not UV-irradiated, or in middle S phase (5 h after release from aphidicolon arrest) were fixed with 0.02% formaldehyde for 10 min, lysed using 0.1% Triton X-100 mCSK buffer (10 mM Pipes, pH 7.9, 100 mM NaCl, 300 mM sucrose, 0.1% (v/v) Triton X-100, 1 mM phenylmethylsulfonyl fluoride, 10 mM β-glycerophosphate, 1 mMNa3VO4, 10 mM NaF), and then sonicated. After centrifugation (30,000 rpm for 20 min at 4°C), the supernatants were mixed with anti-FLAG antibody-conjugated magnetic beads (M8823, SIGMA) for 1 hr at 4°C to obtain immunoprecipitates. The precipitate was washed with ice-cold 0.1% Triton X-100 containing mCSK buffer and subsequently suspended in SDS sample buffer.
RNAi Knockdown Experiments
Double-stranded RNAs were transfected at 100 μM using Oligofectamine (Invitrogen) or HiPerFect (Qiagen). Twenty-four hours after the first transfection, a second transfection was performed and cells were cultured for two more days. The following siRNAs were made by Dharmacon: Skp2; GCAUGUACAGGUGGCUGUU, Cdt2_3’UTR; GCUGAGCUUUGGUCCACUA. The siRNA for siLuc, known as GL2, was used as a control siRNA. For Cdt1 silencing in Figure 1A and B, unsychronized HeLa cells were transfected twice with 200 nM of Cdt1 siRNA or control Luciferase siRNA using Lipofectamine 2000 with a time interval of 24 h and were analysed 48 hours after the second transfection. In synchronized MCF7 cells (Figure 1D) a single transfection with 200 nM of Cdt1 siRNA or control Luciferase siRNA using Lipofectamine 2000 5 hours after release from thymidine and before adding nocodazole was carried out. The Cdt1 siRNA was made by MWG: AACGUGGAUGAAGUACCCGACTT.
Chromatin Fractionation
Cell extracts were prepared using 0.1% Triton X-100-containing mCSK buffer (200 µg of total protein in 400-800 µl). After centrifugation (15,000 rpm for 10 min at 4°C), soluble and chromatin-containing pellet fractions were obtained. The pellet was washed with ice-cold 0.1% Triton X-100 containing mCSK buffer and subsequently suspended in SDS sample buffer.
Protein purification
PCNA: PCNA was purified essentially as a trimer as described (Fukuda et al., 1995). Cell lysate was prepared from pT7-PCNA transformed Rosetta(DE3) and sequentially subjected to Resource Q, Superdex 200, and Mono Q (GE Healthcare Life Science) column chromatography.
Cdt1-3FLAG: The baculoviruses for Cdt1-3FLAG expression were infected into Sf21 insect cells, and cultured at 27°C for 60 hours. Cell lysate was prepared with 0.5M NaCl containing Buffer B (50 mM Tris-HCl, pH8.0, 0.15 M NaCl, 1 mM EDTA, 10% glycerol, 1xProtease inhibitor cocktail (Roche Applied Science), 1 mM PMSF, 2 µg/mL Leupeptin), and passed on DEAE column. The flowthrough fraction was mixed with anti-FLAG resin (Sigma) and Cdt1-3FLAG was eluted with 200µg/mL 3xFLAG peptides (Sigma Aldrich).
RFC complex: The baculoviruses for FLAG-Rfc1, Rfc2, Rfc3, Rfc4 and Rfc5 were co-infected to High Five cells, expressed and purified as described(Shiomi et al., 2000). CRL4Cdt2; the baculoviruses for Cdt2-3FLAG (WT or PIP-3A), DDB1, HA-Cul4 and His-myc-Rbx1 were co-infected into Sf21 cells, and purifies as described (Hayashi et al., 2014). Briefly, the cell lysate was prepared with 0.5M NaCl and 0.5% NonidetP-40 containing Buffer B and clarified by centrifugation and passed on DEAE column. The flowthrough fraction was mixed with anti-FLAG resin and CRL4Cdt2-3FLAG was eluted with Buffer B containing 0.1MNaCl, 0.1%NP-40 and 200 µg/mL 3XFLAG peptide (Sigma Aldrich). If necessary, CRL4Cdt2-3FLAG was loaded on 15-35% glycerol gradient in buffer G (25 mM HEPES pH 7.8, 0.1 M NaCl, 1 mM EDTA, 0.01% NP-40) and subjected to ultra-centrifugation (Beckman TLS-55) at 214,000g for 18 hrs at 4 °C. 100 µl fractions were collected.
In vitro binding assay for Cdt1 and CRL4Cdt2 with PCNA
Cdt1-3FLAG (WT) and CRL4Cdt2-3FLAG (WT)-beads were prepared as follows; (Figure 5B) Cleared lysates were made from insect cells infected with baculoviruses for Cdt1-3FLAG (WT) or CRL4Cdt2-3FLAG (WT), incubated with anti-FLAG magnetic beads pre-blocked with Buffer B containing 50% FBS, 0.5 M NaCl and 0.5%NP-40 and washed with 0.5 M NaCl and 0.5%NP-40 containing Buffer B and then with 0.1 M NaCl and 0.1%NP-40 containing Buffer B. The protein beads prepared as above were incubated with PCNA protein at 4°C for two hours, washed and subjected to Western blotting.
Preparation of nicked circular DNA-beads
Closed circular (cc) DNA-beads were prepared as described (Higashi et al., 2012). Briefly, single stranded DNA templates prepared using pBluescript II KS(-) was annealed with a biotinated oligonucleotide primer (5’-CGCCTTGATCGT [biotin-dT]GGGAACCGGAGCTGAATGAAGC-3’). After second strand synthesis and ligation, covalently closed circular double strand DNA was purified by CsCl/EtBr density gradient centrifugation, incubated with streptavidin and bound to biotin-sepharose beads to produce the cc DNA-beads (around 100ng per 1µl of bead). A single nick was introduced by Nb.BbvCI (New England Biolabs) treatment to produce the nicked circular (nc) DNA-beads. As control beads, biotin-sepharose beads were incubated with streptavidin alone (sa-beads).
PCNA loading and binding assay with purified Cdt1 and CRLCdt2
For loading of PCNA on DNA beads, 2 μl bed volume of nc DNA beads were incubated with 280 ng of RFC and 200 ng of PCNA in 20 μl of 2mM ATP containing HBS buffer (10 mM HEPES pH7.4, 10 mM MgCl2, 0.2 mM EDTA, 0.05 % Tween 20 and 0.15 M NaCl) at 37°C for one hour and washed with HBS buffer three times. The sa-beads were treated in a same way and used as control beads. Beads were incubated with Cdt1 or CRL4Cdt2 alone or with both Cdt1 and CRL4Cdt2 at 4 °C for one hour and washed with HBS buffer. The bound proteins were analyzed on Western blotting.
In vitro binding of PIP box peptides to PCNA
The expression plasmid for full-length human PCNA has been described (Hibbert and Sixma, 2012). Human PCNA was expressed in Bl21 (DE3) E. coli cells (Merck KGaA, Darmstadt, Germany) and purified as described (Hibbert and Sixma, 2012). Peptides – Cdt1PIP (704-717), Cdt1PIP-TAMRA (704-717), Cdt2PIP (1-14) and Cdt2PIP-TAMRA (1-14) were synthesized in-house using Fmoc synthesis. Fluorescence polarization was monitored using a PheraStar plate reader (BMG Labtech) in non-binding 96 well plates (Corning), using an excitation wavelength of 540 nm and an emission wavelength of 590 nm. Experiments were performed in a buffer containing 10 mM HEPES pH 7.5, 125 mM NaCl and 0.5 mM Tris (2-carboxyethyl) phosphine hydrochloride. In the direct binding experiments, 1 nM of labelled peptide was mixed with PCNA at final concentrations ranging from 0 to 2 μM. Error bars represent standard deviations from triplicate experiments. The data were fitted according to standard equations (Littler et al., 2010).
X-ray crystallography structure determination
The purified PCNA was co-crystallized with Cdt2 as well as Cdt1 peptides, using the sitting drop vapour diffusion method in MRC 3-Well Crystallization Plates (Swissci), with standard screening procedures (Newman et al., 2005). The protein solution at 17 mg mL-1 was pre-incubated with an equimolar amount of peptide, and 0.1 μL of this solution was mixed with 0.1 μL of reservoir solution and equilibrated against a 30 μL reservoir. Crystals for the Cdt2 complex were obtained in 10% (w/v) PEG 6000 and 100 mM MES/HCl, pH 6.0. Crystals for the Cdt1 complex were obtained in 15% (w/v) PEG 400, 100 mM calcium acetate and 100 mM MES/HCl, pH 6.0. Crystals appeared at 4 °C within 72 hours. Crystals were briefly transferred to a cryo-protectant solution containing the reservoir solution and 25% (w/v) PEG200 and vitrified by dipping in liquid nitrogen.
Data collection and structure refinement
X-ray data were collected on beamline ID29 at the European Synchrotron Radiation Facility (ESRF). The images were integrated with XDS (Kabsch, 2010) and merged and scaled with AIMLESS (Evans, 2011). The starting phases were obtained by molecular replacement using PHASER (McCoy, 2007) with an available PCNA structure (PDB, 1AXC) as the search model. The models were built using COOT (Emsley et al., 2010) and refined with REFMAC (Murshudov et al., 2011) in iterative cycles. Model re-building and refinement parameter adjustment were performed in PDB-REDO (Joosten et al., 2014); homology-based hydrogen bond restraints (van Beusekom et al., 2018) were used at some stages of the procedure. The quality of the models was evaluated by MOLPROBITY (Chen et al., 2010). Data collection and refinement statistics are presented in Table 1.
Fluorescence recovery after photobleaching (FRAP) experiments and data analysis
Cells (HeLa or MCF7) were plated on 35-mm glass-bottom dishes in phenol-red free medium (Invitrogen). FRAP experiments were conducted as previously described (Giakoumakis et al., 2017; Xouri et al., 2007b). A Leica TCS SP5 microscope equipped with a 63x magnification 1.4 NA oil-immersion lens and FRAP booster were used. During FRAP, cells were maintained at 37°C and 5% CO2. A defined circular region of interest with 2 μm diameter (ROI1) was placed in the nucleus and at the recruitment sites. GFP was excited using a 488 nm Argon laser line. 50 pre-bleach images were acquired with 3% of the 488 nm line at 60% Argon laser intensity, followed by a single bleach pulse on ROI1 using 476 nm and 488 nm laser lines combined at maximum power. In this manner at least 60% of the fluorescence in ROI1 was bleached successfully. Next, 400 post bleach images with a 0.052 sec interval were recorded. Mean intensities of ROI1, the whole nucleus (ROI2) and an area outside of the nucleus (ROI3) were quantified and exported as .csv format files. Data analysis was performed using easyFRAP (Giakoumakis et al., 2017; Koulouras et al., 2018; Rapsomaniki et al., 2012).
Author contributions
Akiyo Hayashi:in vitro biochemical analysis, Cdt2-PIP analysis in cells and made figures, Nickolaos Nikiforos Giakoumakis: Cdt2 recruitment in cells, FRAP analysis, Tatjana Heidebrecht : produced recombinant proteins, performed in vitro biophysical assays and analysed data, and produced crystals, Takashi Ishii: Y2H screening and identification of PCNA and production of Cdt2 PIP-mutant and its initial analysis, Andreas Panagopoulos: Cdt2 N- and C- terminal recruitment in cells, Naohiro Suenaga: Cdt2-N-terminal and C-terminal domain analysis, Christophe Caillat: produced proteins, made initial experiments of PIP box binding, identified PIP box, Michiyo Takahara: isolation of U2OS stables and analysis, Richard G. Hibbert: identified the PIP box from sequence data, Tatsuro Takahashi: assistance for DNA-bead preparation, Magda Stadnik-Spiewak: technical assistance in protein production, Yasushi Shiomi: technical and analytical advice, Stavros Taraviras: supervised in cell analysis, Eleonore von Castelmur: collected and processed crystallographic data, supervised in vitro biophysics experiments, and solved PCNA complex structures, Zoi Lygerou: supervised recruitment and FRAP analysis in cells, contributed to ms writing, Anastassis Perrakis: prepared figures, refined crystal structures, wrote ms, supervised in vitro biophysics and structural work, Hideo Nishitani: supervised the biological characterization, wrote ms, and made figures
Conflict of interest
The authors declare no conflict of interests.
Supplementary Figure legend
Figure S1 A. FRAP analysis of Cdt2 binding to sites of damage in the absence of Cdt1
Quantitative parameters, Immobile fraction and half-maximal recovery time of the mobile fraction (T1/2), corresponding to the FRAP curves described in figure 1C and showing the recovery of Cdt1-eGFP, Cdt2-eGFP, PCNA-eGFP and eGFP-NSL as a control, in undamaged and locally UV-C damaged cells. Mean values with standard deviation, as well as the number of individual cells analysed by FRAP in each case are shown. Normalization and Curve fitting of individual FRAP curves for parameter estimation was performed with easyFRAP. B. FRAP images before, during and after photobleaching at the sites of damage. C. Mean normalized recovery curves of Cdt1-eGFP, Cdt2-eGFP, PCNA-eGFP and eGFP-NSL in undamaged cells. D. Efficiency of synchronization and Cdt1 depletion of MCF7 cells. The percentage of cells expressing Cdt1 or cyclin A is shown for MCF7 cells synchronized in G1, without (siLuc) or with (siCdt1) Cdt1 depletion, as described in figure 1D. E. Quantitative parameters, Immobile fraction and half-maximal recovery time of the mobile fraction (T1/2), corresponding to the FRAP curves described in figure 1D and showing Cdt2 in the presence and absence of Cdt1 in undamaged and locally UV-C damaged cells. Mean values with standard deviation, as well as the number of individual cells analysed by FRAP in each case are shown. Normalization and Curve fitting of individual FRAP curves was done with easyFRAP.
Figure S2. Yeast two hybrid screening identified PCNA as a Cdt2 C-terminus interacting protein.
Figure S3. crystallography: Electron density maps showing the Cdt1 and Cdt1 peptides electron density after structure refinement. The 2mFo-DFc map is contoured to 1.0 rms only around the modelled peptides. A characteristic monomer from the PCNA trimer is show is each case.
Figure S4. Purified proteins used for in vitro assay.
A. Purified Cdt1-3FLAG, PCNA and RFC proteins. B. CRL4Cdt2 complex after purification on FLAG-resins. The asterisks are contaminants. The purified proteins were Western blotted with antibodies for each protein. C. The CRL4Cdt2 complex after purification on FLAG-resins was further purified on glycerol gradient centrifugation. The peak fractions of CRL4Cdt2 tetramer (calculated molecular weight, 313 kDa) were indicated by the dotted line.
Figure S5. Loading of PCNA on nicked circular DNA-beads and following binding assay.
A. Scheme for PCNA loading on nicked circular (nc) DNA and for following Cdt1 and CRL4Cdt2 binding assay. Nicked circular DNA beads or control beads were incubated with PCNA and RFC for 1 hr at 37 °C and were washed (Step1; Loading of PCNA). The beads were then incubated with Cdt1 or CRL4Cdt2 (Step2; Binding). B. RFC dependent loading of PCNA.
Figure S6. Cdt2 PIP-box is important for its recruiting to DNA replication sites and its poly-ubiquitination activity in HEK293 cells.
A. HEK293 cells or cells stable Cdt2WT or Cdt2PIP-3A were pre-extracted, fixed and stained with PCNA and DYKDDDDK (FLAG) antibodies. B. Poly-ubiquitination after UV-irradiation. HEK293 and its stables expressing Cdt2WT or Cdt2PIP-3A were transfected with siCdt2 or control (siLuc). Three days later, cells were treated with MG132 (25 μM), and 10 min later irradiated with UV (20 J/m2). Cells were collected at the indicated time points, and used for Western blotting with indicated antibodies.
Figure S7. Cdt2 PIP-box is important for CRL4Cdt2 activity in U2OS cells.
A. U2OS stable cells expressing Cdt2WT or Cdt2PIP-3A. U2OS cells were transfected with expression vectors for Cdt2WT-FLAG or Cdt2PIP-3A-FLAG, and isolated stable clones were verified by immunofluorescent analysis and Western blot analysis. Frequency of expressing cells for each construct was shown (%). B. Poly-ubiquitination assay with U2OS stable cells. U2OS cells and Cdt2WT-3FLAG or Cdt2PIP-3A-3FLAG expressing stable U2OS cells were treated with MG132 for 3 hr or not (-), and whole cell extracts were prepared for Western blotting. C. Cells were transfected with siCdt2 or control siLuc for 72 hr, irradiated with UV (+, 5 J/m2) or not (-) and collected 1hr later for Western blotting. Relative levels of Cdt1 were shown, set the UV (-) level as 1.0 (average of two independent experiments).
Figure S8. Cdt2PIP-3A mutant shows enlarged nuclei.
Cells transfected with siLuc or siCdt2 for 72 hr were stained with Hoechst 33258.
Acknowledgements
This work was financially supported by JSPS KAKENHI Grant Numbers JP25131718 and JP26291025 (to HN), 25.7320 (to AH), the European Research Council (ERC-StG 281851 and ERC-PoC 755284), the Greek Secretariat for Research and Technology (Bioimaging-GR and Postdoctoral program) (to ZL) and a Greek state scholarship (to AP).
We thank the Advanced Light Microscopy Facility of the University of Patras.