Summary
Genes encoding ribosomal proteins are expressed at rate limiting levels, rendering their biological function highly sensitive to the copy-number variation that results from genomic instability. Cells with a reduced number of ribosomal protein genes (RPGs) are eliminated, when intermingled with wild type cells, via a process known as cell competition. The mechanisms underlying this phenomenon are poorly understood. Here we report the function of a CCAAT-Enhancer-Binding Protein (C/EBP), Xrp1, that is critically required for the elimination of cells with a hemizygous RPG genotype. In such cells, Xrp1 is transcriptionally upregulated by an autoregulatory loop and is able to trigger cell elimination. Since genomic instability is likely to cause the loss of a haploinsufficient RPG, we propose a molecular model of how RPGs, together with a C/EBP-dependent transcriptional program, could preserve the genomic integrity of tissues.
Introduction
Multicellular organisms maintain genomic stability via the activation of DNA repair mechanisms to identify and correct damages present in their DNA, cell cycle arrest to prevent the expansion of DNA damaged cells, and finally programmed cell death to eliminate cells irremediably damaged (Ciccia and Elledge, 2010). The P53 transcription factor plays an evolutionary conserved role in the induction of apoptosis following DNA damage, however evidence points towards the existence of alternative routes for the induction of apoptosis in response to DNA damage (McNamee and Brodsky, 2009; Titen and Golic, 2008). It has been proposed that one of these routes relies on the detection of copy number reduction affecting haploinsufficient ribosomal protein genes (hRPGs) (McNamee and Brodsky, 2009).
Ribosomes are essential macromolecular machines that catalyze the synthesis of proteins in all cells; they consist of a set of ribosomal proteins (RPs) that surround a catalytic core of ribosomal RNAs (rRNAs). The coordinated function of RPs is well illustrated in D. melanogaster. In this model organism, the majority of RPGs is haploinsufficient and give rise to the same dominant phenotype referred to as the Minute phenotype. This phenotype is characterized by a general developmental delay and improper bristle development (Marygold et al., 2007). Haploinsufficient RPGs (hRPGs) are widely distributed across the genome, and owing to their dominant adult phenotype these loci have been used to probe the genetic consequences of diverse sources of chromosome damage (Dekanty et al., 2012). This suggests that hRPGs may be used to report loss of genetic integrity.
In addition, it has recently been shown that removal of one functional copy of a hRPGs activates a number of genes involved in the maintenance of genetic integrity (Kucinski et al. 2017). Furthermore, such prospective loser cells are eliminated when intermingled with wild-type cells, a process that is referred to as “cell competition” (reviewed by Baillon and Basler, 2014). This process occurs irrespectively of the presence of a functional p53 gene (Kale et al., 2015) and therefore provides a suitable assay to uncover molecular circuitries that can trigger apoptosis in destabilized genomes.
Results and Discussion
In order to identify genes whose functions are necessary for the elimination of RPG heterozygous mutant cells, we performed a mosaic forward genetic screen using ethyl methanesulfonate (EMS) in D. melanogaster. We designed a mosaic system that allows direct screening for the persistence of otherwise eliminated loser clones (RpL19 +/−) through the larval cuticle (Fig. 1A,B). Our F1 genetic mosaic system enabled us to screen for a wide spectrum of suppressors, either dominant mutations (anywhere in the genome) or recessive mutations on the right arm of the third chromosome. In brief, the induction of a single somatic recombination event between two FRTs (FLP recognition targets) generates a RPG heterozygous mutant cell that becomes homozygous for the mutagenized right arm of the third chromosome (Fig. 1A). These loser cells/clones are induced at the beginning of larval development (L1). If no suppressive mutation is present, these clones are efficiently eliminated over time such that they are not detectable any more by the end of the third instar larval stage (L3) when the screening is performed (Fig. 1B). This screen should achieve a high degree of specificity since a random mutagenic event is more likely to promote the elimination of a loser cell rather than suppressing it.
We screened 20,000 mutagenized genomes for the presence of mutations that would allow loser clones to persist. We retrieved 12 heritable suppressors (Supplementary Table S1) and focused our attention on three of the strongest suppressors that did not display an obvious growth-related phenotype. These suppressors did not belong to a lethal complementation group and the causative mutations were identified using a combination of positional mapping and whole-genome re-sequencing (see Experimental Procedures). Positional mapping placed the three suppressive mutations within a 100 kilobase interval that contains twelve genes. Sanger sequencing of the respective annotated exons did not reveal the presence of any mutations. We therefore complemented our initial mapping with whole-genome re-sequencing and identified three independent mutations in the introns of CG17836/Xrp1 (Fig. 1C, Supplementary Text and Supplementary Fig. S1,2).
A role for Xrp1 in loser cell elimination has been suggested by genetic association (Lee et al., 2016). Furthermore, Xrp1 expression is mildly upregulated in prospective loser cells (Kucinski et al. 2017). Despite these observations, the functional relevance of Xrp1 in cell elimination remains elusive. In order to confirm that these mutations affect the function of Xrp1 and no other unannotated gene we attempted to rescue these alleles with two different transgenes using a newly designed genetic set-up (see Fig. 1D). The WT genomic fragment restores the elimination of loser cells homozygous for the suppressive mutation Xrp108 while a mutated genomic fragment with a frame-shift mutation fails to do so (Fig. 1E). Taken together, these results indicate that Xrp1 is necessary for the elimination of cells impaired in ribosome biogenesis.
Using a transcriptional reporter for Xrp1 (Xrp102515, containing a lacZ P-element in CG17836, Akdemir et al., 2007), we found that Xrp1 expression is upregulated in RPG +/− cells, indicating that it might play an active role in the elimination of loser cells (Fig. 1F). In order to gain insights into this function we conditionally forced the expression of Xrp1 in the posterior half of the wing discs and observed a massive induction of apoptosis as revealed by anti-cleaved caspase 3 staining (Fig. 1G). We next introduced mutations into the Xrp1 coding sequence and selected for mutants where Xrp1 activity is impaired (Fig. 2A). One of these mutants, Xrp161, contains a frame shift mutation upstream of the Xrp1 basic region-leucine zipper domain (b-ZIP) (Fig. 2B) that completely abrogates its function (Fig. 2A). Xrp161 homozygous mutants are viable and display no obvious phenotypes. This null allele was then used to quantitatively assess the suppressive potential of loss of Xrp1 function on the elimination of RPG mutant cells (RpL19+/−) and to compare it to the potential of other genetic alterations previously implicated in affecting cell competition (Fig. 2C, D, E). We undertook a stringent comparative analysis based on the ratios between the areas of loser (RFP) and winner (GFP) clones (Fig. 2E provides the numerical values of the Fig. 2C). We then analyzed the density distribution across individual samples of the same genotype (Fig. 2E, categorized by 0.1 increments of the ratio between GFP and RFP area). We reasoned that a genuine suppressor of RPG mutant cell elimination should not only increase the mean size of RPG mutant clones but also restore a normal distribution of RPG mutant clones. In the absence of competitive elimination the growth of RPG mutant clones is still affected but these clones should follow a size distribution that is comparable to the one followed by WT clones.
Interestingly, unlike loss of Xrp1, which fully rescues the elimination of RpL19+/− and RpL14+/− loser cells (Fig. 2 C, D, E, and Fig. S5), blocking apoptosis by means of overexpression of dIAPI or p35, or by abrogating dronc or hid function does not fully suppress RPG +/− cell elimination (Fig. 2C, D, E) suggesting that Xrp1 does more than merely induce apoptosis. Xrp1 may additionally hinder cells to progress through the cell cycle; indeed, Xrp1 expression has been reported to induce cell cycle arrest in cultured Drosophila cells (Akdemir et al., 2007). The co-overexpression of CycE (promotes cell-autonomously cell cycle entry (Neufeld et al., 1998) and dIAP1 (represses cell-autonomously apoptosis (Martin et al., 2009) lead to a suppression of RPG +/− cell elimination comparable to that of loss of Xrp1 function (Fig. 2C, D, E). This indicates that the combined effects of blocking cell cycle progression and promoting apoptosis are critical for the elimination of RPG +/− mutant cells. Either one or both of these cellular functions could be directly regulated by Xrp1 at the transcriptional level since Xrp1 possesses a sequence-specific DNA binding domain (b-ZIP, Fig. 2B, Fig. S3).
To further explore this notion we set out to identify direct genomic targets of Xrp1 by chromatin immunoprecipitation followed by deep sequencing (ChIP-seq) on wing imaginal discs (Schertel et al., 2015) (see Fig. 3A). ChIP-seq revealed a high number of Xrp1 binding sites spanning a wide range of affinity (see Fig. 3B, C), and establishes Xrp1 as a C/EBP transcription factor (see Fig. 3C, S4). Some of the top targets comprise a number of genes that are involved in cell cycle regulation, apoptosis, and other biological responses previously associated with the elimination of RPG +/− mutant cells (Fig. 3B). Expression analysis at the mRNA (Fig. 3D) or protein level (Fig. 3E and S6) reveals an up-regulation of genes involved in the induction of apoptosis (hid, Kale et al., 2015), the regulation of innate immunity (Dif, Meyer et al., 2014), and in the establishment of compensatory proliferation (Upd3, Kolahgar et al., 2015) as a response to forced Xrp1 expression. Most interestingly, Xrp1 is able to bind to its own promoter and activate its transcription (Fig. 3D, E). The autoregulation of C/EBPs is a feature that is shared among the members of this family of proteins, and it is typically set in motion via mechanisms that are species-specific (Ramji and Foka, 2002). In Drosophila, the Xrp1 autoamplification loop could serve as a molecular switch to sustain high transcriptional input on Xrp1 targets to orchestrate the elimination of RPG +/− mutant cells.
C/EBP transcription factors have been shown to prevent cell proliferation and induce apoptosis (Ramji and Foka, 2002). Of particular interest is the retention of C/EBP alpha in the nucleolus via binding to ribosomal DNA (Müller et al., 2010). The nucleolus is a distinct structure in the nucleus of eukaryotic cells that forms around the rDNA. It is the site of ribosome biogenesis and a major stress sensor organelle (James et al., 2014). Cells with only a single functional copy of the RpL19 gene (RpL19+/−) have an enlarged nucleolus (Fig. 4A) since RPG insufficiency partially stalls ribosome assembly (Neumueller et al., 2013). Interestingly, Xrp1 binds with a high affinity to many rDNA loci in the genome of D. melanogaster (24 peaks mapped, Fig. 3B). The relationship of Xrp1 with the nucleolus and its functional role in the elimination of cells experiencing RPG imbalance points towards a mechanism whereby cells might use the nucleolus as a reservoir of Xrp1 and release it into the nucleus via a nucleolar stress related mechanism. Once in the nucleus, Xrp1 then switches on its own gene via an autoamplification loop and drive cell elimination (a graphical representation of this working hypothesis is presented in Fig. S7).
When intermingled with wild-type cells, cells having only one functional copy of a hRPG are eliminated in a Xrp1-dependent manner. In our experimental system the deletion of one copy of the RpL19 gene is catalyzed by the Flp/FRT recombination system which leaves no apparent lesion in the chromosomal DNA (Chen and Rice, 2003). Therefore, the trigger for cell elimination does not depend on DNA damage per se but lies within the unbalanced physiology of the cell. The protective function of Xrp1 at the tissue level and the overall benefit of detecting and eliminating cells with RP imbalance are better illustrated under stress conditions. Abrogation of Xrp1 function sensitizes animal to genotoxic stress such as UV-C (Fig. 4B, Table S2) or gamma rays (Akdemir et al., 2007). Furthermore genomic destabilization following the depletion of the spindle assembly checkpoint gene bub3 elevates the levels of Xrp1 expression in the cells that are not yet culled from the epithelia (Fig. 4C and S6). Hence this caretaker mechanism has the potential to preserve genomic integrity at the tissue level by eliminating viable cells that lost genomic integrity. The efficacy of this protective mechanism is probably best illustrated in the context of tumorigenesis for which genomic instability is regarded a major driving force (Hanahan and Weinberg, 2011). We therefore exploited the Flp/FRT recombination system to generate Salvador−/− “ mutant tumor clones. In this system, the loss of one functional copy of the RpL19 gene is sufficient to fully suppress the tumor growth of Salvador−/− mutant clones (Fig. 4D; sav−/− and sav−/−, RpL19+/−). The specific growth arrest mediated by RpL19+/− is released upon abrogation of Xrp1 function (Fig. 4D; sav−/−, RpL19+/−, Xrp1−/−), indicating that the protective function of RPGs haploinsufficiency can also operate within tumorous cells. Taken together these results implicate RPG haploinsufficiency as a potent tumor suppressor mechanism. In addition to the evidence that loss of Xrp1 function works as a suppressor of cell competition-driven elimination of both RpL19+/− and RpL14+/− loser cells (Fig. 2 C, D, E, and Fig. S5), the genome wide distribution of haploinsufficient RPGs (hRPG) across the Drosophila genome (Fig. 4E) further supports the notion that haploinsufficiency at these loci can ensure a prompt response to genomic instability in order to prevent the initiation of tumorigenesis. Haploinsufficiency is the cornerstone of this mechanism since cell elimination is not triggered upon the loss of one functional copy of RpL3, a non-hRPG (Fig. 4F).
Conclusions
Here we have identified a CCAAT/Enhancer Binding Protein (C/EBP), named Xrp1, as an essential component for the elimination of cells with a reduced copy number of ribosomal protein genes when intermingled with wild type cells. We propose that the imbalanced production of ribosomal proteins triggers a C/EBP dependent transcriptional program that orchestrates the elimination of cells at the onset of genetic instability. Key to this mechanism is the observed haploinsufficiency at RPG loci that translate one-to-one a genetic imbalance into a protein imbalance. This resulting physiological readout at the level of ribosome biogenesis triggers a fail-safe mechanism that leads to the elimination of the impaired cell.
Mutagenesis studies in many diploid organisms indicate that the vast majority of genes are haplosufficient (Wilkie, 1994). Diploidy has been proposed to be evolutionarily selected for as a protective mechanism against the deleterious occurrence of somatic mutations (Orr, 1995). In this view, haploinsufficiency may be considered as an evolutionary accident. In D. melanogaster, haploinsufficiency is rare and the vast majority of haploinsufficient genes are RPGs (Cook et al., 2012). The haploinsufficiency at these loci is often attributed to the high cellular demand in RPs (Marygold et al., 2007). However, this is not an inherent feature of these genes since there are nine RPGs that are not associated with a Minute phenotype (RpSA, RpS2, RpS12, RpL3, RpL23, RpL26, RpL29, RpL30, RpL41) and for which no functional compensation is possible by paralogous genes (Marygold et al., 2007). The benefits emerging from RPG haploinsufficiency (Fig. 4F) appear to outweigh the costs (Orr, 1995) of maintaining it, as it provides a simple, yet effective, mechanism to protect the organism from the emergence of potentially deleterious cells. The basic elements of this mechanism (i.e. hRPGs (Barna et al., 2008) at spread-out loci (Uechi et al., 2001), C/EBP (Reinke et al., 2013) and cell competition (Clavería et al., 2013) are conserved, yet it remains to be determined if they function in a similar way in spite of the estimated 600 millions years separating vertebrates from invertebrates. Bearing this in mind, it is tempting to speculate about the therapeutic potential of activating this primitive ribosomal stress response in humans (Fig. 5) since this process occurs irrespectively of the presence a functional p53 gene (Kale et al., 2015) and since human cancer cells are often mutated for RPGs (Fig. S8) (Nijhawan et al., 2012).
Experimental Procedures
Drosophila strains and cultures
Flies were grown on a standard cornmeal medium at 25°C unless otherwise specified. The P{salm-GAL4.E}2nd (Denise Nellen, FBrf0211371, 4.8 kbp EcoRI fragment 2L:11459156‥n454345 Dmel_r6.08), the P{EP}dIAP1 (Chloé Häusermann, line W85 EP insertion at 3L:16046907 Dmel_r6.08) and the P{en2.4-GAL4}e16E, P{UAS-mCD8::GFP.L}LL5, P{tubP-GAL80ts} chromosome (Ryohei Yagi) were generated in our laboratory. The M{UAS-Xrp1.ORF.3xHA.GW}ZH-86Fb (F000655) were obtained from FlyORF. The P{UAS-E2F},P{UAS-DP}2nd (#4774), P{PZ}Xrp102515 (#11569), P{Act5C>y+>GAL4-w}, Df(2R)M60E, P{lacW}RpL19k03704, P{FRT}82B, P{FRT}80B, P{tubP-GAL80}LL3, P{tubP-GAL80}LL9, P{Ubi-GFP(S65T)nls}3R, P{Ubi-GFP.D}61EF, the insertion mutants P{A92}RpS3Plac92 (Minute) and P{SUPor-P}RpL3KG05440 (non-Minute) were obtained from the Bloomington Drosophila Stock Center. The P{UAS-CycEg}2nd (Lane et al., 1996) and P{UAS-cycD}, P{UAS-cdk4}2nd (Meyer et al., 2000) were provided by Christian Lehner. The P{UAS-mCherry-CAAX}2nd (Kakihara et al., 2008) was obtained from Shigeo Hayashi. The P{PZ}hid05014, P{FRT}80B and the DroncO1, P{FRT}80B stocks were provided by Wei Du (Tanaka-Matakatsu et al., 2009). The p535A-1-14 corresponds to a 3498 bp deletion within p53 gene (3R:23,048,029‥23,055,526 Flybase R6.14). The P{GSV6}Xrp1GS18143 (#200976) was obtained from the DGRC Kyoto stock center. Additionally the P{UAS-p35}2nd (Hay et al., 1994), the P{Rab5}2nd (Entchev et al., 2000) the P{UAS-puckered}2nd (Martín-Blanco et al., 1998), the sav4 (Tapon et al., 2002) were used. P{Act5C>GAL4-w} was obtained by flipping out the y+ FRT cassette of P{Act5C>y+>GAL4-w}. The P{Bub3-dsRNA-GD9924}2nd was obtained from the VDRC.
Cloning of transgenes and transgenesis
The RpL19 3.08 kbp genomic rescue (2R:24967017‥24970096 Dmel_r6.08) was amplified from a genomic DNA template, sequence confirmed, cloned within the NotI restriction site of the pUAST.attB and inserted into the attP landing site ZH-attP-86Fb (3R tester line) and ZH-attP-68E (3L tester line) (Bischof et al., 2007). The Xrp1 15.88 kbp BamHI-BglII genomic rescue (3R:18911505‥18927381 Dmel_r6.08) was digested from CH321-38O16 of the P[acman] BAC Libraries (Venken et al., 2009), sequence confirmed, cloned into the pattB vector (Bischof et al., 2013) and inserted into the attP landing site ZH-attP-68E. The Xrp1 mutated genomic rescue was generated by inserting 5bp (C> GATCCC at 3R:18925226 Dmel_r6.08) at the beginning of the second coding exon in the wild-type genomic fragment, which shifts the frame of all Xrp1 isoforms. Transgenesis was performed according to standard germ-line transformation procedures.
RPG loser clone induction and scoring
RpL19+/− loser clones in vivo screen: y, w, P{hs-FLP}; M{3xP3-RFP.attP}ZH-36B; P{FRT}82B mutagenized males were crossed to y, w, P{UAS-mCD8::GFP.L}LL4, P{hs-FLP}; P{salm-GAL4.E}2nd, Df(2R)M60E; P{FRT}82B, P{tubP-GAL80}LL3, M{RpL19 genomic}ZH-86Fb/ SM5a-TM6B tester virgin females. Parents were allowed to lay eggs for 24 hours and RpL19+/− loser clones were heat-shock induced for 30 minutes at 37°C, 24-48 hours after egg deposition. Progeny were screened at the end of the third instar larval stage when larvae stop feeding and move away from the food. No water was added nor was heat-shock applied to force the remaining larvae out of the food as it is routinely done. Special attention was given to the final larval density in the tubes since we noticed that it negatively influences loser clone elimination. In our hands optimal density for cell competition is achieved when the food is neither dry nor soggy; this proper balance is achieved when late third instar larvae climb up to 2/3 of the tube height without reaching the tube’s cotton plug. Consequently only such tubes were screened for the persistence of RpL19+/− GFP positive clones through the larval cuticle of living larvae.
RpL19+/− loser clones for dissections: males of the appropriated genotype were crossed to the “3R” or “3L” tester virgin females. “3R” tester virgin females: y, w, P{hs-FLP}; P{Act5C>GAL4-w}, P{UAS-mCherry-CAAX}2nd, Df(2R)M60E; P{FRT}82B, P{Ubi-GFP(S65T)nls}3R, P{tubP-GAL80}LL3, M{RpL19 genomic}ZH-86Fb/SM5a-TM6B. “3L” tester virgin females: y, w, P{hs-FLP}; P{Act5C>GAL4-w}, P{UAS-mCherry-CAAX}2nd, Df(2R)M60E; P{Ubi-GFP.D}61EF, P{tubP-GAL80}LL9, M{RpL19 genomic}ZH-68E, P{FRT}80B/ SM5a-TM6B. Clones were heat-shock induced as mentioned above.
RpL14+/− loser clones for dissections: males of the appropriated genotype were crossed to tester virgin females. (A) y, w (B) y, w, P{hs-FLP};; Xrp161 and y w;; M{UAS-RpL14.ORF} ZH-86Fb / TM6B. Tester virgin females: y, w, P{UAS-mCD8::GFP.L}LL4, P{hs-FLP};; P{lacW}RpL141, M{salm FRTRpL14 genomic FRT GAL4}ZH-86Fb, Xrp161 / TM6B. Parents were allowed to lay eggs for 8 hours and loser clones were heat-shock induced for 15 minutes at 37°C, 44-52 hours after egg deposition. Yeast was added to the tubes 24 hours after the heat-shock was applied.
Progeny were screened at the end of the third instar larval stage when larvae stop feeding and move away from the food. No water was added nor was heat-shock applied to force the remaining larvae out of the food.
Mutagenesis and screen
EMS mutagenesis screens were performed according to standard procedure (Bökel, 2008). y, w, P{hs-FLP}; M{3xP3-RFP.attP}ZH-36B; P{FRT}82B starter line was first isogenized for the 3R cell competition screen. Isogenized males were fed with a 25 mM EMS, 1% sucrose solution and crossed to tester virgin females. RpL19+/− clones were induced in the resulting progeny. A total of 20,000 F1 larvae were screened for the persistence of RpL19+/− GFP positive clones at the end of the third instar larval stage. 182 larvae showed persistence of GFP clones clearly above background noise. 125 of them gave rise to fertile adults and were further rescreened. 12 heritable suppressors were doubly balanced. For the Xrp1 “coding sequence directed mutagenesis” y, w; +; P{GSV6}Xrp1GS18143/TM3,Sb males were fed with a 50 mM EMS, 1% sucrose solution and crossed to tester virgin females y, w, P{ey-FLP}; P{Act>y+>GAL4-w}; M{3xP3-RFP.attP}ZH-86Fb. 10,000 F1 genomes were screened and 8 heritable suppressors were retrieved and balanced. A mutation in the Xrp1 coding region was identified in 5 of them. After the causative mutation was identified the upstream P{GSV6}Xrp1GS18143 was removed using P element transposase and precise excision events were selected (direct sequencing of PCR amplicons) and recombined onto a P{FRT}82B chromosome for clonal analysis. RpL19 knock-out was generated by mobilizing the P element P{lacW}RpL19k03704, imprecise excisions were selected based on the presence of the characteristic Minute bristle phenotype and the absence of the white+ marker. The RpL19IE-C5 1.09 kbp deletion (2R:24968426‥24969517 Dmel_r6.08) was selected and characterized using direct sequencing of PCR amplicons. This specific excision removes all of RpL19’s coding sequence and leaves neighboring genes unaffected.
Mapping the mutations
We initially mapped cell competition suppressors through meiotic recombinations coupled with DHPLC (Denaturing High-Performance Liquid Chromatography, Eliane Escher) for PCR amplicon analysis. The interval containing the suppressors Xrp108 and Xrp129 was narrowed down to a 106.5 Kb interval (3R:18872668‥18979166 Dmel_r6.08). Sanger sequencing of the coding regions in this interval did not reveal the presence of any mutation. We then performed whole-genome sequencing on Xrp108, Xrp120 and Xrp129 with the Illumina’s Genome analyser IIx (Genomics Platform of the University of Geneva). Mutations were identified by visual inspection of the sequences in this interval: Xrp108 (T>A 3R:18921364 Dmel_r6.08), Xrp120(C>T 3R:18920194 Dmel_r6.08), Xrp129(G>A 3R:18921450 Dmel_r6.08). Other suppressors were roughly mapped to the second chromosome or to one of the arms of the third chromosome as indicated in the test complementation table. Minute mutants were identified on the basis of their characteristic bristle phenotype and developmental delay. warts and Salvador mutants were identified on the basis of their clonal overgrown phenotypes and failure to complement independent loss of function alleles (wartsm72 and sav4). Note that for sup88 the suppressive mutation is the Minute on the second chromosome and not the mutation in the salvador gene. Xrp1 suppressors isolated from the “coding sequence directed mutagenesis” were identified by direct sequencing of PCR amplicons: Xrp102 (G>A 3R:18926271 Dmel_r6.08), Xrp126 (C>T 3R:18926088 Dmel_r6.08), Xrp137 (C>T 3R:18926394 Dmel_r6.08), Xrp139 (C>T 3R:18925431 Dmel_r6.08), Xrp161 (TC>ACA 3R:18925609‥18925610 Dmel_r6.08).
qRT-PCR
qRT-PCR was performed according to standard protocol. Supplementary Figure S2: RNA was extracted with TRIzol Reagent and genomic DNA was digested with the Ambion DNase kit. RNA was isolated from third instar wing imaginal discs with the exception of the reaction 1-6 where RNA was extracted from third instar larvae. Primer sequences are oriented 5’ to 3’. Primer 1(GCGTAGCAGAAAAGACAAGTGA), 2(CGACACAAGTTCCC CTTAAAC), 3(TCATTGTTTCTTTCTAACGGTCAA), 4(GGTTGCTGTTGTTTG ATTCG), 5(CCTACTGCCACAGTTGAAGAGATAGACG), 6(TTGCTTCTATGT CTTGCAGGTATT), 7(GACCACACCGGAGATTATCAA), 8(GCTGGTACTGGT ACTTGTGGTG).
Figure 3D: RNA was extracted with TRIzol Reagent and genomic DNA was digested with the Invitrogen DNase kit. RNA was isolated from third instar wing imaginal discs. Target gene expression levels were measured in y, w, hsFlp;; Act5C>CD2, y+>GAL4, UAS-GFP / UAS-Xrp1 wing discs and compared to y, w, hsFlp;; Act5C>CD2, y+>GAL4, UAS-GFP / UAS-LacZ control wing discs. GAL4 expressing clones were induced 4 days AED with a 45 minutes heat shock at 37°C. Wing discs were dissected 24 hours after clone induction. Primer sequences are oriented 5’ to 3’. Xrp1 3’UTR Fw (CGTTGAAGAAGTCGAGAAGCA), Xrp1 3’UTR Rev (TAAACACTCCTCGCGCACTA), hid Fw (GTGGAGCGAGAACGACAAA), hid Rev (TTGGCCAAGTGAAGCTCTGT), Upd3 Fw (CCCAGCCAACGATTTTTATG), Upd3 Rev (TGTTACCGCTCCGGCTAC), Dif Fw (GTGGAGCTGAAACTAGTGAGACC), Dif Rev (GGCGATTGTGTTTGGTTAGG), Nedd4 Fw (GACCCTGGTGAATCTGCCTA), Nedd4 Rev (CCGGATAAAGGCGTGGTAG).
ChIP-seq preparation and analysis
Drosophila wing imaginal discs expressing HA tagged Xrp1 (FlyORF-F000655) (Bischof et al., 2013) were mass isolated/sorted, chromatin was immunoprecipitated and DNA libraries were prepared according to standard protocol (Schertel et al., 2015). Libraries were sequenced on the Illumina HiSeq 2500 v4 (Functional Genomics Center of the University of Zurich). Bowtie 2 (version 2.0.0-beta6) (Langmead and Salzberg, 2012) was used to align the sequencing reads using default parameters. The dm3 Drosophila genome annotation was used as reference. The program findPeaks.pl with default parameters was used to identify enriched regions compared to the untreated control sample. The program find MotifsGenome.pl (with the option size =75) was used to identify predominant motifs de novo. Only the one motif very significantly enriched (p-value ≪ 1e-50) was considered as advised in the software description. The sequence logo was generated with the PWM-Tools web interface (http://ccg.vital-it.ch/pwmtools/) from the SIB using HOMER’s position frequency matrix output file. Position (A C G T): 1 (0.252 0.046 0.078 0.624), 2 (0.178 0.089 0.344 0.389), 3 (0.468 0.001 0.362 0.169), 4 (0.001 0.560 0.011 0.428), 5 (0.001 0.001 0.997 0.001), 6 (0.590 0.275 0.001 0.134), 7 (0.997 0.001 0.001 0.001), 8 (0.997 0.001 0.001 0.001), 9 (0.082 0.213 0.001 0.704), 10 (0.305 0.287 0.176 0.232).
Data access
ChIP-seq data and whole-genome resequencing data from this study will be submitted to the NCBI Gene Expression Omnibus data repository.
Antibodies
Inmunostainings on Drosophila wing discs were performed according to standard protocol. The following antibodies were used: rabbit anti-Cleaved-Caspase-3 (Asp175, Cell Signaling), mouse anti-β-Galactosidase (Z3781, Promega), mouse anti-Fibrillarin (38F3; Santa Cruz). The rabbit anti-Dif antibody was obtained from Ylva Engström, the monoclonal mouse anti-Hid antibody was obtained from Hermann Steller, the rabbit anti-Nedd4 antibody was obtained from Shigeo Hayashi, the rat anti-Twins antibody was obtained from Tadashi Uemura and the rabbit anti-Upd3 antibody was obtained from Yu-Chen Tsai. The following secondary antibodies were used: goat anti-mouse Alexa Fluor 647, goat anti-rabbit Alexa Fluor 647 and goat anti-rat Alexa Fluor 647 (Molecular Probes). For the chromatin IP the rabbit anti-HA ChIP grade antibody (ab9110, Abcam) was used. Image processing and clone size measurements were done with FIJI.
Generation of imaginal wing discs with RpL19+/− and RpL19+/+ compartments
Genotype: y, w, P{hs-FLP}; P{Act5C>GAL4-w}, P{UAS-mCherry-CAAX}2nd, Df(2R)M60E/RpL19IE-C5 ; P{FRT}82B, P{Ubi-GFP(S65T)nls}3R, P{tubP-GAL80}LL3, M{RpL19 genomic}ZH-86Fb/P{FRT}82B. Such larvae were heat-shocked 15 min at 37°C during L1. Wing discs were dissected at the end of the third instar larval stage, fixed and stained. Wing discs containing RpL19+/− and RpL19+/+ compartments were imaged.
Identification of Xrp1 homologs
Heuristic approach. Two iterations of PSI-BLAST (Altschul et al., 1997) were performed using the bZIP domain of Xrp1 as a query. The COBALT constraint-based multiple protein alignment tool provided on the BLAST interface (Papadopoulos and Agarwala, 2007) was used to align all Drosophila Xrp1 protein sequences with the human C/EBPs family members identified with the PSI-Blast search. Non-heuristic approach. BZip containing proteins from human and D. melanogaster were searched, aligned and trimmed according to the bZIP_2 motif from Pfam (PF07716) using probabilistic hmmer profiles (Eddy, 1998) (hmmer.org). The resulting alignment was visualized with the CLC Main Workbench and then used for phylogenetic reconstruction using the PhyML algorithm (Guindon and Gascuel, 2003) with LG substitution models (Le and Gascuel, 2008), SPR topological rearrangements (Hordijk and Gascuel, 2005) and 100 bootstrap replicates. Phylogenetic tree was then midpoint rooted and displayed with the iTOL online tool (Letunic and Bork, 2007).
UV-C treatment
L1 larvae (yw and Xrp161) were exposed to different intensity of UV-C (254 nm) on apple-agar plates and then transferred to standard cornmeal medium. Percentage of eclosed animals was scored as well as the percentage of adults exhibiting obvious phenotypes (bristle number/morphology, eye/notum/wing malformations and melanotic masses).
RPGs cancer-deletion profiling
The RPG cancer-deletion analyses was performed for each of the 79 human RPGs using the TUMORSCAPE query function based on the GISTIC analysis (Mermel et al., 2010). Deletions for RPGs were significantly detected within the 14 cancer subtypes that regroups more than 80% (2549/3131) of the cancer samples on which the GISTIC analysis is based. This analysis identifies genes that are significantly deleted across the datasets and may therefore underestimate the extend of RPGs deletion due to intra-tumour heterogeneity. Cancer subtypes with GISTIC-based RPG deletions include: Acute lymphoblastic leukemia (391 cancer samples, including 13 cell lines), Breast (243 cancer samples, including 50 cell lines), Colorectal (161 cancer samples, including 33 cell lines), Esophageal squamous (44 cancer samples, including 12 cell lines), Glioma (41 cancer samples, including 13 cell lines), Hepatocellular (121 cancer samples, including 11 cell lines), Lung NSC (733 cancer samples, including 105 cell lines), Lung SC (40 cancer samples, including 23 cell lines), Medulloblastoma (128 cancer samples, including 9 cell lines), Melanoma (111 cancer samples, including 108 cell lines), Myeloproliferative disorder (215 cancer samples, including 0 cell lines), Ovarian (103 cancer samples, including 7 cell lines), Prostate (92 cancer samples, including 9 cell lines), Renal (126 cancer samples, including 27 cell lines).
Drosophila RPGs map / gene density
Gene coordinates for each chromosome arm were retrieved using the cytosearch tool of Flybase. Gene positions were considered as the middle point between the start and the end of each gene. Gene density was calculated for 40 kbp bins and the final map was visualized using the radar chart type of Excel. The percentage of intragenic sequences was calculated as the complement of the total size of the genome minus the sum of the intergenic sequences downloaded from Flybase (Genome, FTP, r6.1).
Acknowledgments
I would like to thank Konrad Basler for offering me the possibility to join his laboratory and for being such a kind-hearted PhD advisor. I am thankful to Claudia Rockel for carrying out the Chromatin IP, the libraries preparation and for handling the ChIP-seq data, to Jochen Hilchenbach for performing the RT-PCR experiments (quantification of target gene expression), and to Federico Germani for outlining the areas of the clones and performing the test with the RpL14 flip-out cassette. I wish to thank Johannes Bischof for invaluable comments on earlier versions of this manuscript, Eliane Escher (DHPLC genotyping, Sanger sequencing), Nellcia Wang (mass isolation and sorting of wing imaginal discs for the ChIP-seq). I am grateful to Christian von Mering for his guidance on phylogenetic tree construction and to Werner Boll for his help with confocal microscopy. I am grateful to Shigeo Hayashi, Christian Lehner, Wei Du, Marco Milan, Hermann Steller, Ylva Engström, Tadashi Uemura, Shigeo Hayashi, Yu-Chen Tsai for sharing reagents and ideas. I apologize to the researchers whose work could not be cited due to space limitations. This work was supported by the Swiss National Science Foundation and the University of Zurich.