Report of Partial Findings from the National Toxicology Program Carcinogenesis Studies of Cell Phone Radiofrequency Radiation in Hsd: Sprague Dawley® Sd Rats …
M Wyde, M Cesta, C Blystone, S Elmore, P Foster… - BioRxiv, 2016 - biorxiv.org
… GSM or CDMA modulation were continuously monitored in real-time during all exposure
periods via RF sensors located in each exposure chamber that recorded RF field strength (V/m). …
periods via RF sensors located in each exposure chamber that recorded RF field strength (V/m). …
Evaluation of the genotoxicity of cell phone radiofrequency radiation in male and female rats and mice following subchronic exposure
SL Smith‐Roe, ME Wyde, MD Stout… - Environmental and …, 2020 - Wiley Online Library
The National Toxicology Program tested two common radiofrequency radiation (RFR)
modulations emitted by cellular telephones in a 2‐year rodent cancer bioassay that included …
modulations emitted by cellular telephones in a 2‐year rodent cancer bioassay that included …
Dose-additive carcinogenicity of a defined mixture of “dioxin-like compounds”
…, JK Haseman, M Yin, ME Wyde… - Environmental …, 2005 - ehp.niehs.nih.gov
Use of the dioxin toxic equivalency factor (TEF) approach in human risk assessments assumes
that the combined effects of dioxin-like compounds in a mixture can be predicted based …
that the combined effects of dioxin-like compounds in a mixture can be predicted based …
Effect of cell phone radiofrequency radiation on body temperature in rodents: Pilot studies of the National Toxicology Program's reverberation chamber exposure …
ME Wyde, TL Horn, MH Capstick… - …, 2018 - Wiley Online Library
Radiofrequency radiation (RFR) causes heating, which can lead to detrimental biological
effects. To characterize the effects of RFR exposure on body temperature in relation to animal …
effects. To characterize the effects of RFR exposure on body temperature in relation to animal …
The environmental pollutant 1, 1-dichloro-2, 2-bis (p-chlorophenyl) ethylene induces rat hepatic cytochrome P450 2B and 3A expression through the constitutive …
ME Wyde, E Bartolucci, A Ueda, HE Zhang, B Yan… - Molecular …, 2003 - ASPET
… J00719) forward (tgagaacctcatgatctccctgc) and reverse (aggaaaccatagcggagtgtgg) primers
were designed with the following parameters: low T m = 60C, high T m = 64C, optimum T m = …
were designed with the following parameters: low T m = 60C, high T m = 64C, optimum T m = …
Di-n-Butyl Phthalate Activates Constitutive Androstane Receptor and Pregnane X Receptor and Enhances the Expression of Steroid-Metabolizing Enzymes in the …
ME Wyde, SE Kirwan, F Zhang, A Laughter… - Toxicological …, 2005 - academic.oup.com
… The design parameters were as follows: low T m = 60C, high T m = 64C, optimum T m =
62, amplicon length = 80–150 bp, and primer length 20–24 bp, with an optimum of 22 bp. …
62, amplicon length = 80–150 bp, and primer length 20–24 bp, with an optimum of 22 bp. …
Induction of Hepatic 8-Oxo-deoxyguanosine Adducts by 2,3,7,8-Tetrachlorodibenzo-p-dioxin in Sprague−Dawley Rats Is Female-Specific and Estrogen-Dependent
ME Wyde, VA Wong, AH Kim, GW Lucier… - Chemical research in …, 2001 - ACS Publications
… After incubation, 7.6 M sodium iodide and 20 mM disodium ethylenediamine tetraacetate
(EDTA) in 40 mM Tris-HCl buffer (pH 8.0) (kit sodium iodide solution) was added. DNA was …
(EDTA) in 40 mM Tris-HCl buffer (pH 8.0) (kit sodium iodide solution) was added. DNA was …
Reproductive lesions in female Harlan Sprague-Dawley rats following two-year oral treatment with dioxin and dioxin-like compounds
…, AE Brix, DM Sells, MP Jokinen, M Wyde… - Toxicologic …, 2009 - journals.sagepub.com
Results from previously published animal studies suggest that prenatal and postnatal
exposure to dioxin and dioxin-like compounds (DLCs) may profoundly affect the reproductive …
exposure to dioxin and dioxin-like compounds (DLCs) may profoundly affect the reproductive …
Exocrine pancreatic pathology in female Harlan Sprague-Dawley rats after chronic treatment with 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin and dioxin-like compounds.
…, AE Brix, DM Sells, ME Wyde… - Environmental …, 2004 - ehp.niehs.nih.gov
We evaluated the effect of chronic exposure to dioxin and dioxin-like compounds on the
pancreas in female Harlan Sprague-Dawley rats. This investigation represents part of an …
pancreas in female Harlan Sprague-Dawley rats. This investigation represents part of an …
Thyroid Follicular Lesions Induced by Oral Treatment for 2 Years with 2,3,7,8-Tetrachlorodibenzo-p-dioxin and Dioxin-like Compounds in Female Harlan Sprague …
…, AE Brix, DM Sells, ME Wyde - Toxicologic …, 2010 - journals.sagepub.com
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and structurally-similar dioxin-like compounds
affect thyroid function and morphology and thyroid hormone metabolism in animals and …
affect thyroid function and morphology and thyroid hormone metabolism in animals and …