… GSM or CDMA modulation were continuously monitored in real-time during all exposure
periods via RF sensors located in each exposure chamber that recorded RF field strength (V/m). …

The National Toxicology Program tested two common radiofrequency radiation (RFR)
modulations emitted by cellular telephones in a 2‐year rodent cancer bioassay that included …

Use of the dioxin toxic equivalency factor (TEF) approach in human risk assessments assumes
that the combined effects of dioxin-like compounds in a mixture can be predicted based …

Radiofrequency radiation (RFR) causes heating, which can lead to detrimental biological
effects. To characterize the effects of RFR exposure on body temperature in relation to animal …

… J00719) forward (tgagaacctcatgatctccctgc) and reverse (aggaaaccatagcggagtgtgg) primers
were designed with the following parameters: low T m = 60C, high T m = 64C, optimum T m = …

… The design parameters were as follows: low T m = 60C, high T m = 64C, optimum T m =
62, amplicon length = 80–150 bp, and primer length 20–24 bp, with an optimum of 22 bp. …

… After incubation, 7.6 M sodium iodide and 20 mM disodium ethylenediamine tetraacetate
(EDTA) in 40 mM Tris-HCl buffer (pH 8.0) (kit sodium iodide solution) was added. DNA was …

Results from previously published animal studies suggest that prenatal and postnatal
exposure to dioxin and dioxin-like compounds (DLCs) may profoundly affect the reproductive …

We evaluated the effect of chronic exposure to dioxin and dioxin-like compounds on the
pancreas in female Harlan Sprague-Dawley rats. This investigation represents part of an …

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and structurally-similar dioxin-like compounds
affect thyroid function and morphology and thyroid hormone metabolism in animals and …