Astrocytic LRRK2 Controls Synaptic Connectivity through ERM Phosphorylation
===========================================================================

* Shiyi Wang
* Dhanesh Sivadasan Bindu
* Christabel Xin Tan
* Kristina Sakers
* Tetsuya Takano
* Maria Pia Rodriguez
* Kylie Dimond
* Scott H. Soderling
* Albert R. La Spada
* Cagla Eroglu

## Abstract

Astrocytes tightly control neuronal connectivity and function in the brain through direct contact with synapses1–5. These glial cells become reactive during disease pathogenesis6–8 including Parkinson’s disease (PD)9–14. However, it remains unknown if astrocyte dysfunction is an initiating factor of PD pathogenesis and whether astrocytes can be targeted to stop or reverse the synaptic dysfunction seen in PD. Using *in vitro* and *in vivo* methods, we found that the PD-linked gene Lrrk2 controls astrocyte morphology via regulating the phosphorylation of ERM proteins (Ezrin, Radixin, and Moesin), a structural component of the perisynaptic astrocyte processes. ERM phosphorylation is robustly elevated both in mice and humans carrying the LRRK2 G2019S Parkinsonism mutation. Importantly, the reduction of the ERM phosphorylation, specifically in the LRRK2 G2019S in adult astrocytes, is sufficient to restore excitatory synapse number and function deficits in the LRRK2 G2019S knock-in mouse cortex. These results show a role for Lrrk2 in controlling astrocyte morphogenesis and synaptogenic function and reveal that early astrocyte dysfunction in PD could be causal to disruptions in cortical excitatory synaptic connectivity. The astrocytic dysfunction can be corrected by dampening ERM phosphorylation, pinpointing astrocytes as critical cellular targets for PD therapeutics.

## Main Text

Astrocytes instruct the formation and function of synaptic circuits3, 12, 15. Most synapses in the central nervous system are in direct contact with perisynaptic astrocyte processes16–19. This structural association is essential for the regulation of synaptic function; therefore, the perisynaptic astrocyte process and the pre- and postsynaptic neuronal compartments were coined the term “the tripartite synapse”18, 20. At the tripartite synapse, astrocytes clear excess neurotransmitters, maintain ion homeostasis, and secrete factors regulating synapse development and function21–25. To accomplish these crucial roles at the synapse, astrocytes gain a highly elaborate morphology and form a network coupled through gap junctions to continuously tile the entire brain parenchyma2, 19, 26. Previous studies found that astrocyte morphogenesis, tiling, and neuronal synaptogenesis are interdependent processes controlled by bidirectional signaling via secreted factors and cell adhesion molecules27–32.

Astrocytes become reactive in numerous neurological disorders, including Parkinson’s Disease (PD)33, 34. PD is a progressive neurodegenerative motor disorder affecting over 8 million people worldwide35–37. PD is commonly diagnosed at the onset of motor symptoms, including tremors, bradykinesia, and rigidity. By the time these motor symptoms are apparent, the PD patients have already lost many of their dopaminergic neurons in their substantia nigra pars compacta (SNPc)38, 39. However, decades before the onset of motor dysfunction, individuals with PD often display non-motor symptoms, such as cognitive, mood, and sleep disorders40–43. These clinical observations suggest that during the early phases of PD, synaptic circuit dysfunction exists across multiple brain regions, including the cerebral cortex44, 45. Recent studies suggested that astrocytes contribute to neurodegeneration in PD by producing neurotoxic factors, increasing glutamate-mediated excitotoxicity, disrupting K+ buffering and Ca2+ homeostasis10, 46, 47. However, it remains unknown if astrocyte dysfunction is an initiating factor or a reaction to neuronal pathology in PD.

### Astrocytic LRRK2 controls astrocyte morphology through ERM phosphorylation

Even though most PD cases are idiopathic, ∼15% are caused by mutations in Parkinsonism genes48. The PD-linked genes identified to date point to dysfunction in fundamental cellular processes such as lysosome and mitochondria function, vesicular trafficking, and secretion49–51. However, how the dysfunction of these genes results in impaired synaptic circuits and dopaminergic neuron death is unknown. Moreover, many cell types in the brain and body express these PD-linked genes52–54. Thus, the cellular origins of PD may not be restricted to neurons.

Mutations in the leucine-rich repeat kinase 2 (*LRRK2*) gene cause familial PD55, 56. In particular, the LRRK2 G2019S is the most common mutation that causes familial PD43, 49, 57. It is largely accepted that LRRK2 G2019S is a gain-of-function mutation that increases LRRK2’s kinase activity58–63. PD patients with the LRRK2 G2019S mutation exhibit symptoms and disease progression that resembles idiopathic PD, such as late-onset disease, responsiveness to L-DOPA treatment, and the presence of Lewy body and Tau-tangle pathology64, 65. PD patients with the LRRK2 G2019S mutation also have non-motor symptoms, such as depression, hallucinations, and sleep and cognitive disorders43, 57, 66. Several rodent models with LRRK2 G2019S mutation have been generated; however, these models do not show motor dysfunction or dopaminergic neuron loss67–69. However, non-motor symptoms such as cognitive dysfunction is common in PD, indicating impairments in numerous brain regions, including the cerebellar cortex70, 71. Previous human and rodent studies showed that LRRK2 is highly expressed in the cortex and LRRK2 G2019S alters cortical and cortico-striatal circuits and causes cognitive problems such as impaired goal-directed actions, reflecting critical non-motor symptoms of PD72–81.

Because astrocytes play essential roles in cortical circuit formation and function5, 82, and cortical connectivity is altered in PD, we tested whether mouse and rat cortical astrocytes express Lrrk2. Using a knockout (KO)-verified LRRK2 antibody83, 84, we visualized the expression of Lrrk2 protein in cortical mouse astrocytes by immunostaining coronal brain sections from wild-type (WT) or LRRK2 G2019S knock-in (ki/ki) mice76, 85. These mice also contained the Aldh1l1-eGFP transgene28, labeling all astrocytes with GFP. Lrrk2 staining was evident in both WT and LRRK2 G2019S mouse astrocytes, localizing throughout astrocytic processes (Extended Data Fig. 1a-b). Similarly, cortical astrocytes from WT or LRRK2 G2019S BAC transgenic rats also express Lrrk2 *in vitro,* which we verified by immunoblotting (Extended Data Fig. 1c-d; Extended Data Fig. 1e-f).

To investigate the function of LRRK2 in astrocyte morphogenesis, we first utilized a primary rat cortical astrocyte and neuron co-culture system to examine how the loss of Lrrk2 affects astrocyte morphology. To do so, we knocked down Lrrk2 with a short hairpin RNA (shRNA) that targets both the rat and mouse *Lrrk2* (Extended Data Fig. 1g-h). In this neuron-astrocyte co-culture assay, we isolated WT (unmanipulated) cortical neurons and astrocytes from neonatal rats and cultured them separately for 9 days *in vitro* (DIV). Astrocytes were then transfected with GFP-tagged shRNA against *Lrrk2* (sh*Lrrk2*) or a scrambled control shRNA (shControl). Two days post-transfection, astrocytes were plated onto DIV11 WT neurons (Fig. 1a). As previously shown28, 86, astrocytes transfected with shControl acquired a complex morphology in response to 48 hours of neuronal contact (Fig. 1b). On the contrary, Lrrk2 knockdown stunted astrocyte morphological complexity (Fig. 1b). To avoid possible off-target effects from shRNA, we also isolated cortical astrocytes from LRRK2 KO rats87–90. We examined their morphological complexity in response to contact with WT neurons. Like sh*Lrrk2* astrocytes, LRRK2 KO astrocytes had significantly diminished arborization compared to WT rat astrocytes, indicating that Lrrk2 is required for neuron-induced astrocyte morphogenesis *in vitro* (Fig. 1b).

![Figure 1.](http://biorxiv.org/https://www.biorxiv.org/content/biorxiv/early/2023/04/10/2023.04.09.536178/F1.medium.gif)

[Figure 1.](http://biorxiv.org/content/early/2023/04/10/2023.04.09.536178/F1)

Figure 1. Astrocytic LRRK2 controls astrocyte morphology by balancing ERM phosphorylation levels *in vitro*
**a,** Schematic of astrocyte-neuron co-culture assay. **b,** (Upper) Rat cortical astrocytes transfected with scrambled shRNA (shControl-GFP) or shRNA targeting LRRK2 (sh*Lrrk2*-GFP) and LRRK2 knockout (KO) rat cortical astrocytes co-cultured with wild-type cortical neurons. Scale bar, 10 μm. (Lower) Quantification of astrocyte branching complexity. n = 56 (shControl-GFP), 54 (sh*Lrrk2*-GFP), 52 (LRRK2 KO) astrocytes co-cultured with wild-type (WT) cortical neurons compiled from three independent experiments. We fitted a linear mixed model with the number of intersections as an outcome variable, condition as a predictor, and the number of cells and cell radius were entered as random effects. Within this model, sh*Lrrk2* (beta = 5.91, t(171) = 12.59) and LRRK2 KO (beta = 5.43, t(171) = 11.28) led to a significant decrease of number of intersections compared to shControl (beta = 12.37, t(171) = 25.72). Tukey multiple comparisons test revealed a significant difference between shControl-GFP and LRRK2 KO (*p* < 0.001) and between shControl-GFP and sh*Lrrk2*-GFP (*p* < 0.001). Tukey multiple comparisons test revealed no difference between sh*Lrrk2*-GFP and LRRK2 KO (*p* = 0.7579). **c,** WT or LRRK2 G2019S rat cortical astrocytes transfected with GFP and co-cultured with WT cortical neurons or LRRK2 G2019S cortical neurons. Scale bar, 10 μm. **d,** Quantification of astrocyte branching complexity. n = 61 (WT), 61 (LRRK2 G2019S) astrocytes co-cultured with WT cortical neurons compiled from three independent experiments. n = 41 (WT), 40 (LRRK2 G2019S) astrocytes co-cultured with LRRK2 G2019S cortical neurons compiled from two independent experiments. We fitted a linear mixed model with number of intersections as outcome variable, condition as predictor and number of cells and cell radius were entered as random effects. Within this model, LRRK2 G2019S (beta = 7.55, t(113) = 18.95) led to a significant decrease of number of intersections compared to WT astrocytes (beta = 10.86, t(113) = 28.47). WT (beta = 7.12, t(152) = 15.44) and LRRK2 G2019S (beta = 6.49, t(152) = 13.72) astrocytes co-cultured on LRRK2 G2019S neurons led to a significant decrease of number of intersections compared to WT astrocytes co-cultured with WT neurons (beta = 14.42, t(152) = 30.09). Tukey multiple comparisons test revealed no difference between WT and LRRK2 G2019S astrocytes co-cultured on LRRK2 G2019S neurons (*p* = 0.7696). Tukey multiple comparisons test revealed a significant difference between WT and LRRK2 G2019S astrocytes co-cultured on WT neurons (*p* = 1.99E-09). **e,** WT astrocytes treated with DMSO, 30 nM MLi-2, or 100 nM MLi-2 were lysed and subjected to Western blotting. Western blotting was performed using phospho-ERM, ERM, phospho-Rab10, and Rab10 antibodies. Results are representative of 4 independent experiments. **f,** Densitometric analysis of phospho-ERM levels in Fig. 1e. Signals corresponding to phospho-ERM were normalized to that for ERM. Statistical significance was determined by One-way ANOVA [F (2, 9) = 354.8, *p* < 0.0001], Bonferroni multiple comparison revealed a significant difference between 0 nM and 30 nM MLi-2 treatments (*p* < 0.0001, 95% C.I. = [0.6566, 0.8600]) and between 0 nM and 100 nM MLi-2 treatments (*p* < 0.0001, 95% C.I. = [0.7341, 0.9375]) and no differences between 30 nM and 100 nM MLi-2 treatments (*p* = 0.1568, 95% C.I. = [-0.02422, 0.1792]), alpha = 0.05. **g,** WT or LRRK2 G2019S astrocytes were lysed and subjected to Western blotting, using phospho-ERM and ERM antibodies. Results are representative of 3 independent experiments. **h,** Densitometric analysis of phospho-ERM levels in Fig. 1g. Signals corresponding to phospho-ERM were normalized to that for ERM. Statistical significance was determined by Unpaired Two-tailed t-test [t (5.944) = 5.536], *p* = 0.0015. **i,** (Upper) Representative rat cortical astrocytes transfected shControl-GFP + WT EZRIN, shControl-GFP + Phospho-mimetic EZRIN, and co-cultured with WT cortical neurons. Scale bar, 10 μm. (Lower) Quantification of astrocyte branching complexity. n = 47 (shControl-GFP + WT EZRIN O/E), 46 (shControl-GFP + Phospho-mimetic EZRIN O/E) astrocytes co-cultured with WT cortical neurons compiled from three independent experiments. We fitted a linear mixed model with number of intersections as outcome variable, condition as predictor and number of cells and cell radius were entered as random effects. Within this model, neither WT EZRIN (beta = 14.76, t(107) = 19.17) or Phospho-mimetic EZRIN (beta = 13.22, t(107) = 19.07) lead to significant changes of number of intersections of shControl-GFP astrocytes (beta = 12.75, t(107) = 19.82). Tukey multiple comparisons test revealed no difference between shControl-GFP and shControl-GFP + WT EZRIN O/E (*p* = 0.1110), shControl-GFP and shControl-GFP + Phospho-mimetic EZRIN O/E (*p* = 0.8727), and shControl-GFP + WT EZRIN O/E and shControl-GFP + Phospho-mimetic EZRIN O/E (*p* = 0.2969). **j,** (Upper) Representative rat cortical astrocytes transfected sh*Lrrk2*-GFP + WT EZRIN, sh*Lrrk2*-GFP + Phospho-mimetic EZRIN, and co-cultured with WT cortical neurons. Scale bar, 10 μm. (Lower) Quantification of astrocyte branching complexity. n = 55 (sh*Lrrk2*-GFP + WT EZRIN O/E), 47 (sh*Lrrk2*-GFP + Phospho-mimetic EZRIN O/E) astrocytes co-cultured with WT cortical neurons compiled from three independent experiments. We fitted a linear mixed model with number of intersections as outcome variable, condition as predictor and number of cells and cell radius were entered as random effects. Within this model, WT EZRIN (beta = 4.99, t(162) = 10.32) did not increase the number of intersections of sh*Lrrk2*-GFP astrocytes but Phospho-mimetic EZRIN (beta = 15.27, t(162) = 27.93) increased number of intersections of shLRRK2-GFP astrocytes (beta = 4.80, t(162) = 10.63). Tukey multiple comparisons test revealed no difference between sh*Lrrk2*-GFP and sh*Lrrk2*-GFP + WT EZRIN O/E (*p* = 0.9926). Tukey multiple comparisons test revealed significant difference between sh*Lrrk2*-GFP and sh*Lrrk2*-GFP + Phospho-mimetic EZRIN O/E (*p* < 0.0001). **k-l,** (Upper) Representative WT **(k)** or LRRK2 G2019S **(l)** rat astrocytes transfected GFP + WT EZRIN, or GFP + Phospho-dead EZRIN, and co-cultured with WT cortical neurons, respectively. Scale bar, 10 μm. (Lower) Quantification of astrocyte branching complexity. n = 57 (WT + WT EZRIN O/E), 66 (WT + Phospho-dead EZRIN O/E), 57 (LRRK2 G2019S + WT EZRIN O/E), 48 (LRRK2 G2019S + Phospho-dead EZRIN O/E) astrocytes co-cultured with WT cortical neurons compiled from three independent experiments. We fitted a linear mixed model with number of intersections as outcome variable, condition as predictor and number of cells and cell radius were entered as random effects. Within this model, WT EZRIN (beta = 13.49, t(137) = 25.15) did not change the number of intersections of WT astrocytes, but Phospho-dead EZRIN (beta = 5.37, t(137) = 10.02) decreased number of intersections of WT astrocytes (beta = 10.86, t(137) = 24.82). WT EZRIN (beta = 7.52, t(209) = 15.91) did not change the number of intersections of LRRK2 G2019S astrocytes but Phospho-dead EZRIN (beta = 10.88, t(209) = 22.54) increased number of intersections of LRRK2 G2019S astrocytes (beta = 7.55, t(209) = 16.77). Tukey multiple comparisons test revealed a significant difference between LRRK2 G2019S and LRRK2 G2019S + Phospho-mimetic EZRIN O/E (*p* = 2.03E-06), and LRRK2 G2019S + WT EZRIN O/E and LRRK2 G2019S + Phospho-mimetic EZRIN O/E (*p* = 4.83E-06). Tukey multiple comparisons test revealed no difference between LRRK2 G2019S and LRRK2 G2019S + WT EZRIN O/E (*p* = 0.9999), and between WT and LRRK2 G2019S + Phospho-mimetic EZRIN O/E (*p* = 0.9999). Data are presented as mean ± s.e.m.

To study how LRRK2 G2019S affects astrocyte morphological complexity, we isolated cortical astrocytes from WT or LRRK2 G2019S BAC-transgenic rats87–89 and examined their morphological complexity in response to contact with WT neurons *in vitro*. We found that LRRK2 G2019S rat astrocytes showed a reduction in astrocyte complexity compared to WT astrocytes (Fig. 1c-d). These results suggest that both loss and gain of LRRK2 kinase function impair astrocyte morphogenesis *in vitro*.

To determine if neuronal LRRK2 G2019S mutation could impact astrocyte morphogenesis in a cell non-autonomous manner, we cocultured WT or LRRK2 G2019S astrocytes with LRRK2 G2019S neurons. When cultured on top of LRRK2 G2019S neurons, the WT astrocytes also displayed reduced arborization, indicating that LRRK2 G2019S mutation bi-directionally impairs astrocyte-neuron signaling required for astrocyte morphogenesis (Fig. 1c-d). These results show that LRRK2 G2019S impairs astrocyte morphology in both a cell-autonomous and non-cell autonomous manner, illustrating important roles for astrocytic and neuronal Lrrk2 function in establishing proper astrocyte-neuron contacts.

Lrrk2 is a large multidomain protein containing ROC (Ras of complex), COR (C-terminal of ROC), catalytic kinase, and 4 protein-protein interactions domains (armadillo, ankyrin, leucine-rich repeats, WD40 domains)64, 91, 92. The PD-linked mutation, LRRK2 G2019S, is in the kinase domain and is known to increase LRRK2 kinase activity *in vitro* and *in vivo*58–60, 62. Previous studies identified numerous intracellular proteins (Rab8A, Rab10, endophilin A1, auxillin, ribosomal protein s15, N-ethylmaleimide sensitive fusion protein, synaptojanin, and P62/SQSTM1) as LRRK2 kinase substrates62, 93–99. LRRK2 plays critical roles in ciliogenesis, lysosome function, immune system, and synaptic vesicle trafficking by phosphorylation of its substrates100–115.

ERM proteins (Ezrin, Radixin, and Moesin) are structural components of perisynaptic astrocyte processes (PAPs)16, 17. LRRK2 phosphorylates a conserved threonine residue present in all ERM proteins60, 116, 117. When phosphorylated, ERM proteins change conformation and link the F-actin cytoskeleton to the cell membrane118, 119. This switch is thought to play an important role in organizing cell morphology by allowing process outgrowth119, 120. Among the ERM proteins, ezrin is specifically and highly enriched in astrocytes (Extended Data Fig. 1i-j) and is known to preferentially localize at the perisynaptic astrocyte processes16. Genetic ablation or down regulation of ezrin has been shown to reduce astrocyte morphological complexity *in vivo*121–123. Given these potential functional links between LRRK2 and ERM proteins, we wondered whether Lrrk2 controls astrocyte morphology via ERM phosphorylation (phospho-ERM).

To determine if LRRK2 function in astrocytes is required for ERM phosphorylation, we analyzed the levels of phospho-ERM in WT rat astrocytes treated with two different doses of MLi-2, a highly specific LRRK2 kinase inhibitor and compared phospho-ERM levels to the vehicle (DMSO) treated astrocyte cultures using immunoblotting. The well-established LRRK2 phosphorylation substrate Rab10 served as a control for this assay61, 100, 103. As expected, MLi-2 treatment inhibited Rab10 phosphorylation (Fig. 1e). We found that, compared to astrocytes treated with DMSO, both 30 and 100 nM MLi-2 treatment decreased phospho-ERM levels in WT rat astrocytes by ∼75%, indicating that LRRK2 kinase function is required for ERM phosphorylation in astrocytes (Fig. 1f). Next, we compared the levels of ERM phosphorylation in astrocytes isolated from WT or LRRK2 G2019S rats and found an increase (increased by ∼100%) in ERM phosphorylation in LRRK2 G2019S astrocytes (Fig. 1g-h). These data reveal an important role for LRRK2 in mediating ERM phosphorylation in astrocytes *in vitro*. These findings also suggest that LRRK2 controls astrocyte morphology by regulating ERM phosphorylation levels.

### ERM phosphorylation state underlies Lrrk2-mediated astrocyte morphological complexity

Because both loss of Lrrk2 function (shRNA and LRRK2 KO) and gain of Lrrk2 kinase function (LRRK2 G2019S) perturbed astrocyte morphogenesis, we hypothesized that a balance between phosphorylated and unphosphorylated ERM protein levels may be crucial for regulating astrocyte morphological complexity. To test this hypothesis, we manipulated the balance between phosphorylated and unphosphorylated ERM in sh*Lrrk2*-transfected or LRRK2 G2019S astrocytes using two EZRIN mutants with phosphorylation-mimicking or -deficient properties. Switching the amino acid threonine (T) at location 567 with aspartate (D) results in a conformation of EZRIN that mimics a constitutively phosphorylated state124, 125. On the other hand, mutating the same residue T567 to alanine (A) results in a version of the protein that cannot be phosphorylated: phospho-dead EZRIN119, 120. Phospho-dead EZRIN binds to the plasma membrane like WT EZRIN but is poorly associated with the actin cytoskeleton119, 120, 126, 127.

We first tested if overexpressing phospho-mimetic EZRIN in sh*Lrrk2*-transfected astrocytes would rescue their morphology. Astrocytes transfected with shControl, and WT EZRIN or phospho-mimetic EZRIN served as controls. In these experiments, only astrocytes were manipulated and plated onto WT rat neurons. WT or phospho-mimetic EZRIN transfection did not change the morphological complexity of shControl astrocytes (Fig. 1i). However, overexpression of phospho-mimetic EZRIN, but not WT EZRIN, fully rescued the complexity of sh*Lrrk2* astrocytes (Fig. 1j).

We next tested if increasing unphosphorylated EZRIN would rescue the morphogenesis of LRRK2 G2019S astrocytes. To do so, we isolated cortical astrocytes from WT or LRRK2 G2019S rats, and over-expressed WT or phospho-dead EZRIN, and plated transfected astrocytes on WT cortical neurons. We found that overexpression of WT EZRIN did not change the morphology of WT or LRRK2 G2019S astrocytes. However, overexpression of the phospho-dead EZRIN reduced the morphological complexity of WT astrocytes (Fig. 1k). Conversely, overexpression of the phospho-dead EZRIN fully rescued the morphological complexity of LRRK2 G2019S astrocytes *in vitro* (Fig. 1l). These results show that LRRK2 mediates astrocyte morphological complexity by regulating ERM phosphorylation and strongly suggest that the balance between phosphorylated and unphosphorylated ERM proteins is needed for neuronal contact-induced astrocyte morphogenesis.

To determine if LRRK2 G2019S mutation impacts ERM phosphorylation in astrocytes *in vivo*, we examined the levels of phospho-ERM in coronal brain sections from 21-day-old (P21) and 12-week-old WT or LRRK2 G2019Ski/ki mice in which astrocytes were labeled via the Aldh1L1-eGFP transgene. When compared to WTs, we observed an increase in phospho-ERM staining in both P21 and 12-week-old LRRK2 G2019Ski/ki mice. This increase was not uniform but rather localized exclusively to some of the astrocytes within the layers L1 and L2/3 of the anterior cingulate cortex (ACC) and the primary motor cortex (MOp) (Fig. 2a-c; Extended Data Fig. 2a-b). In P21 LRRK2 G2019Ski/ki mice, the phospho-ERM integrated densities in the ACC Layer 1 and Layer 2/3 and the MOp Layer 1 and Layer 2/3 were increased by ∼412% and ∼158% compared to the WTs, respectively (Fig. 2d). In 12-week-old (P84) LRRK2 G2019Ski/ki mice, the phospho-ERM integrated densities in the ACC Layer 1 and Layer 2/3 and in the MOp Layer 1 and Layer 2/3 were increased by ∼700% and ∼398% compared to the WTs, respectively (Extended Data Fig. 2c). However, the phospho-ERM integrated density in neighboring brain regions such as the primary somatosensory cortex (SSp) and dorsal medial striatum (DMS) was not different between LRRK2 G2019Ski/ki or WTs (Extended Data Fig. 2h). These findings show that LRRK2 G2019S mutation induces aberrant ERM phosphorylation in astrocytes. Intriguingly, this increase in ERM phosphorylation is not uniform but rather localized to ACC and MOp, which are cortical regions that are impacted in PD patients128–130.

![Figure 2.](http://biorxiv.org/https://www.biorxiv.org/content/biorxiv/early/2023/04/10/2023.04.09.536178/F2.medium.gif)

[Figure 2.](http://biorxiv.org/content/early/2023/04/10/2023.04.09.536178/F2)

Figure 2. Astrocytic LRRK2 controls astrocyte morphology by balancing ERM phosphorylation levels *in vivo*
**a-c**, Representative confocal images of ERM phosphorylation (purple) in the anterior cingulate cortex (ACC) and primary motor cortex (MOp) of WT or LRRK2 G2019Ski/ki Aldh1l1-eGFP transgenic mice at P21. Scale bar, 200 μm (**a-b**). Scale bar, 10 μm (**c**). **d,** Quantification of phospho-ERM integrated density in **a-b**, n = 4 (WT, 2 males and 2 females), 4 (LRRK2 G2019Ski/ki, 2 males and 2 females) mice, For phospho-ERM quantification in the ACC, nested t-test, unpaired Two-tailed t-test. t (16) = 15.16, *p* < 0.0001. For phospho-ERM quantification in the MOp, nested t-test, unpaired Two-tailed t-test. t (14) = 8.963, *p* < 0.0001. Grey dots are the data acquired from each image. Black dots are the averaged data acquired from each WT mouse. Blue dots are the averaged data acquired from each LRRK2 G2019Ski/ki mouse. **e,** Images of ACC and MOp layer 2/3 WT and LRRK2 G2019Ski/ki astrocytes at P21 expressing PB-mCherry-CAAX ± Phospho-dead EZRIN. Astrocyte territory in cyan. Scale bar, 10 μm. **f,** Average territory volumes of P21 astrocytes. n = 16 (WT; 6 mice), 18 (WT + Phospho-dead EZRIN O/E; 6 mice), 16 (LRRK2 G2019S; 6 mice), 17 (LRRK2 G2019S + Phospho-dead EZRIN O/E; 6 mice). Statistical significance was determined by One-way ANOVA [F (3, 20) = 7.987, *p* = 0.0011], Bonferroni multiple comparisons revealed a significant difference between WT and LRRK2 G2019S (*p* = 0.0178, 95% C.I. = [0.4542, 6.313]), between WT and WT + Phospho-dead EZRIN O/E (*p* = 0.0037, 95% C.I. = [1.132, 6.991]), and between WT + Phospho-dead EZRIN O/E and LRRK2 G2019S + Phospho-mimetic EZRIN O/E (*p* = 0.0165, 95% C.I. = [-6.346, -0.4875]), and no differences between WT and LRRK2 G2019S + Phospho-mimetic EZRIN O/E (*p* > 0.9999, 95% C.I. = [-2.284, 3.574]), between LRRK2 G2019S and WT + Phospho-dead EZRIN O/E (*p* > 0.9999, 95% C.I. = [-2.251, 3.608]), and between LRRK2 G2019S and LRRK2 G2019S + Phospho-mimetic EZRIN O/E (*p* = 0.0763, 95% C.I. = [-5.668, 0.1908]), alpha = 0.05. Data points are mouse averages. **g,** Quantification of astrocyte branching complexity. n = 16 (WT; 6 mice), 18 (WT + Phospho-dead EZRIN O/E; 6 mice), 16 (LRRK2 G2019S; 6 mice), 17 (LRRK2 G2019S + Phospho-dead EZRIN O/E; 6 mice). Two-way ANOVA for repeated measures. Main effects of conditions [F (2.505, 3305) = 158.4, *p* < 0.0001] and radius [F (88, 1602) = 218.5, *p* < 0.0001] and interaction [F (264, 3958) = 10.62, *p* < 0.0001]. Bonferroni multiple comparisons revealed a significant difference between WT and LRRK2 G2019S (*p* < 0.0001, 95% C.I. = [16.09, 26.40]), between WT and WT + Phospho-dead EZRIN O/E (*p* < 0.0001, 95% C.I. = [29.06, 39.54]), between LRRK2 G2019S and WT + Phospho-dead EZRIN O/E (*p* < 0.0001, 95% C.I. = [7.6, 18.52]), between LRRK2 G2019S and LRRK2 G2019S + Phospho-dead EZRIN O/E (*p* < 0.0001, 95% C.I. = [-22.19, -13.43]), and between WT + Phospho-dead EZRIN O/E and LRRK2 G2019S + Phospho-dead EZRIN O/E (*p* < 0.0001, 95% C.I. = [-37.02, -24.72]), and no difference between WT and LRRK2 G2019S + Phospho-dead EZRIN O/E (*p* = 0.5469, 95% C.I. = [-1.932, 8.796]). **h,** Images of ACC and MOp layer 2/3 astrocytes at P21 expressing shControl-mCherry-CAAX or sh*Lrrk2*-mCherry-CAAX ± Phospho-mimetic EZRIN. Astrocyte territory in cyan. Scale bar, 10 μm. **i,** Average territory volumes of P21 astrocytes. n = 18 (shControl; 6 mice), 18 (shControl + Phospho-mimetic EZRIN O/E; 5 mice), 22 (sh*Lrrk2*; 6 mice), 19 (sh*Lrrk2* + Phospho-mimetic EZRIN O/E; 7 mice). Statistical significance was determined by One-way ANOVA [F (3, 20) = 5.674, *p* = 0.0056], Bonferroni multiple comparison revealed a significant difference between shControl and sh*Lrrk2* (*p* = 0.0104, 95% C.I. = [0.5585, 5.322]), and between sh*Lrrk2* and sh*Lrrk2* + Phospho-mimetic EZRIN O/E (*p* = 0.0114, 95% C.I. = [-5.096, -0.5065]), and no differences between shControl and shControl + Phospho-mimetic EZRIN O/E (*p* > 0.9999, 95% C.I. = [-1.426, 3.570]), between shControl and sh*Lrrk2* + Phospho-mimetic EZRIN O/E (*p* > 0.9999, 95% C.I. = [-2.156, 2.433]), and between shControl + Phospho-mimetic EZRIN O/E and sh*Lrrk2* + Phospho-mimetic EZRIN O/E (*p* > 0.9999, 95% C.I. = [-3.349, 1.482]), alpha = 0.05. Data points are mouse averages. **j,** Quantification of astrocyte branching complexity. n = 16 (shControl), 24 (shControl + Phospho-mimetic EZRIN O/E), 23 (sh*Lrrk2*), 18 (sh*Lrrk2* + Phospho-mimetic EZRIN O/E). Two-way ANOVA for repeated measures. Main effects of conditions [F (2.435, 7008) = 225.0, *p* < 0.0001] and radius [F (88, 8633) = 325.4, *p* < 0.0001] and interaction [F (264, 8633) = 5.908, *p* < 0.0001]. Bonferroni multiple comparisons revealed a significant difference between shControl and sh*Lrrk2* (*p* < 0.0001, 95% C.I. = [31.02, 40.20]), between sh*Lrrk2* and shControl + Phospho-mimetic EZRIN O/E (*p* < 0.0001, 95% C.I. = [-38.59, -29.67]), between sh*Lrrk2* and sh*Lrrk2* + Phospho-mimetic EZRIN O/E (*p* < 0.0001, 95% C.I. = [-34.32, -25.69]), between shControl and sh*Lrrk2* + Phospho-mimetic EZRIN O/E (*p* = 0.0139, 95% C.I. = [0.7510, 10.47]), and between shControl + Phospho-mimetic EZRIN O/E and sh*Lrrk2* + Phospho-mimetic EZRIN O/E (*p* = 0.0188, 95% C.I. = [0.4426, 7.813]), and no difference between shControl and shControl + Phospho-mimetic EZRIN O/E (*p* > 0.9999, 95% C.I. = [-3.083, 6.044]). Data are presented as mean ± s.e.m. **k,** Schematic representation of analyzed human brain regions for phospho-ERM staining, frontal cortex. **l,** Representative confocal images of GFAP (green) and ERM phosphorylation (purple) in the frontal cortex of human control subjects or human PD patients carrying LRRK2 G2019S mutation carriers at age >80 years old. Scale bar, 200 μm. n = 4 (Human control, 3 males and 1 female), 3 (LRRK2 G2019S mutation carriers, 2 males and 1 female) subjects. **m,** Quantification of phospho-ERM integrated density in **l**, n = 4 (Human control, 3 males and 1 female), 3 (LRRK2 G2019S mutation carriers, 2 males and 1 female) subjects, nested t-test, unpaired Two-tailed t-test. t (4) = 3.551, *p* = 0.0238. The grey dot is the data acquired from each image. The black dot is the averaged data acquired from each control subject. The blue dot is the averaged data acquired from each LRRK2 G2019S mutation carrier. **n,** Quantification of GFAP integrated density in **l**, n = 4 (Human control, 3 males and 1 female), 3 (LRRK2 G2019S mutation carriers, 2 males and 1 female) subjects, nested t-test, unpaired Two-tailed t-test. t (18) = 3.612, *p* = 0.0020. Grey dots are the data acquired from each image. Black dots are the averaged data acquired from each control subject. Blue dots are the averaged data acquired from each LRRK2 G2019S mutation carrier.

To determine the *in vivo* functions of astrocytic Lrrk2, we examined astrocyte morphological complexity in Layer 1 and Layer 2/3 of ACC and MOp of LRRK2 G2019Ski/ki mice. To do so, we used postnatal astrocyte labeling by electroporation (PALE) combined with the PiggyBac transposon system to introduce a membrane-targeted fluorescent label (mCherry-CAAX) into a sparse population of cortical astrocytes in WT and LRRK2 G2019Ski/ki mice at P0 (Extended Data Fig. 2k). At P21, following the period of astrocyte growth and extensive elaboration, the territory volumes for LRRK2 G2019S astrocytes were significantly smaller (reduced by ∼34%) than WT astrocytes (Fig. 2f). In addition, compared to WT astrocytes, the branching complexity of LRRK2 G2019S astrocytes was reduced (Fig. 2g). The reduction in astrocyte size and complexity in LRRK2 G2019Ski/ki astrocytes did not result in an increase in the numbers of astrocytes in these brain regions. (Extended Data Fig. 3a-e). The number of Aldh1L1-EGFP/Sox9 double-positive astrocytes in these brain regions was similar in WT and LRRK2 G2019Ski/ki mice (Extended Data Fig. 3c). However, there were patches within ACC and MOp parenchyma in LRRK2 G2019Ski/ki mice in which the EGFP-positive astrocyte processes had noticeably reduced. These changes in astrocytes were not due to a typical reactive gliosis phenotype because we did not detect any increase in the levels of GFAP, which differentially labels reactive astrocytes in the cortical grey matter (Extended Data Fig. 3f). Taken together, these results reveal that LRRK2 G2019S mutation reduces astrocyte morphological complexity without affecting astrocyte numbers or reactivity *in vivo*.

To determine if LRRK2 G2019S-mediated astrocyte morphological deficits are due to the phospho-ERM upregulation in astrocytes, we tested whether phospho-dead EZRIN can rescue the morphological complexity of LRRK2 G2019S astrocytes *in vivo*. To do so, we performed PALE to introduce mCherry-CAAX and phospho-dead EZRIN into astrocytes of WT or LRRK2 G2019Ski/ki mice. Like our *in vitro* results, the overexpression of phospho-dead EZRIN in WT astrocytes is sufficient to decrease the territory volume and morphological complexity (Fig. 2e-g). However, the overexpression of phospho-dead EZRIN restored LRRK2 G2019S astrocyte territory volume and complexity (Fig. 2f-g). These results indicate that balancing phosphorylated and unphosphorylated ERM levels is crucial for regulating astrocyte morphology, and overexpression of phospho-dead EZRIN can rescue morphological deficits of LRRK2 G2019S astrocytes *in vivo*.

To further test this hypothesis, we studied if knocking down LRRK2 in WT astrocytes affects astrocyte morphological complexity *in vivo*. We introduced shControl or sh*Lrrk2* into a sparse population of cortical astrocytes in WT mice by using PALE. We found that, like LRRK2 G2019S astrocytes, sh*Lrrk2* astrocytes had significantly smaller territory volumes (reduced by ∼36%) and reduced morphological complexity when compared to shControl astrocytes (Fig. 2h-j). To determine whether phospho-mimetic EZRIN can restore astrocyte morphology in LRRK2 knockdown astrocytes *in vivo*, we performed PALE to introduce either sh*Lrrk2* or shControl together with phospho-mimetic EZRIN overexpression vector into astrocytes of the ACC and MOp. We found that over-expression of phospho-mimetic EZRIN in shControl astrocytes did not change astrocyte territory volume (Fig. 2h-i). However, expression of phospho-mimetic EZRIN in sh*Lrrk2*-containing astrocytes restored astrocyte territory volume and morphological complexity up to the WT levels (Fig. 2j). Taken together, these findings revealed that the balance between phosphorylated and unphosphorylated ERM is crucial for LRRK2-mediated astrocyte morphological complexity *in vivo*. Disrupting the balance of ERM phosphorylation status in astrocytes compromises astrocyte morphological complexity, and modulation of this balance can be used to restore astrocyte morphology in the LRRK2 G2019S genotype.

### ERM phosphorylation is upregulated in the frontal cortices of PD patients carrying LRRK2 G2019S mutation

To determine if phospho-ERM abundance is altered in PD patients carrying LRRK2 G2019S mutation, we stained frontal cortices from 3 patients who carry this mutation and compared them to age and sex-matched donors (Supplemental Table 1). We observed that, compared to sex and age-matched human control subjects, the overall levels of phosphorylated ERM were robustly increased by 7-fold in the frontal cortex of PD patients carrying the LRRK2 G2019S mutation (Fig. 2m). The elevated signal of phospho-ERM is often surrounded by GFAP positive astrocytes and astrocyte processes. The astrocytic organization, determined by GFAP staining, appeared to be disrupted in PD patients carrying the LRRK2 G2019S mutation (Fig. 2l). We observed increased GFAP levels in grey matter astrocytes (increased by ∼42%) of LRRK2 G2019S mutation carriers, suggesting the presence of reactive gliosis in PD patients carrying LRRK2 G2019S mutation (Fig. 2n). These data indicate that ERM phosphorylation is dysregulated in PD patients carrying the LRRK2 G2019S mutation. Together, our data show that phospho-ERM levels are elevated in the cortices of PD patients with LRRK2 G2019S mutation. The increase in phospho-ERM is concurrent with reactive gliosis and astrocyte morphology changes. Distinct from the P21 and 3-month-old LRRK2 G2019Ski/ki mice where phospho-ERM was restricted to astrocytes, in the human patient brains (∼80 years old), we also saw phospho-ERM accumulation outside the GFAP-labelled astrocytes. This observation suggests a role for aberrant ERM phosphorylation in multiple cell types in later stages of PD caused by the LRRK2 G2019S mutation.

### LRRK2 G2019S mutation disrupts excitatory and inhibitory synapse numbers and function in the cortex

Astrocyte morphological complexity is a crucial indicator of proper astrocyte-synapse interactions that control synapse numbers2, 27, 131–133. LRRK2 G2019Ski/ki mice revealed no dopaminergic neuron loss or motor dysfunction68, 69; however, synapse dysfunction at cortico-striatal circuits was observed in adult mice. For example, LRRK2 G2019S alters presynaptic glutamatergic transmission and disrupts glutamate receptor trafficking at striatal postsynaptic terminals72, 76, 85, 134–136. However, whether LRRK2 G2019S affects cortical connectivity is unknown. Given the critical role of LRRK2 in synapses and PD-related cortical circuits137–141, we next investigated the role of LRRK2 G2019S mutation in synaptic connectivity in the ACC and MOp (Fig. 3a). To quantify the density of structural cortical synapses, we used the Vesicular Glutamate Transporter 1 (VGlut1) and the postsynaptic density protein 95 (PSD95) or the Vesicular GABA Transporter (VGAT), and gephyrin (GEPHYRIN), which mark the respective pre- and post-synaptic compartments of intracortical excitatory and inhibitory synapses142–146 (Fig. 3b). Structural synapses were identified as the apposition and co-localization of pre and postsynaptic markers, which are in two distinct neuronal compartments (i.e., axons and dendrites) and would only appear to co-localize at synapses due to their close proximity147.

![Figure 3.](http://biorxiv.org/https://www.biorxiv.org/content/biorxiv/early/2023/04/10/2023.04.09.536178/F3.medium.gif)

[Figure 3.](http://biorxiv.org/content/early/2023/04/10/2023.04.09.536178/F3)

Figure 3. LRRK2 G2019S affects excitatory and inhibitory synapse number and function in the ACC and MOp
**a,** Schematic representation of analyzed brain regions (ACC and MOp) for excitatory and inhibitory synapse numbers. **b,** Schematic representations of methodologies used to quantify the VGluT1-PSD95 and VGAT-GEPHYRIN colocalized puncta. **c,** (Left) Representative images from the ventral ACC layer 1 of WT and LRRK2 G2019Ski/ki mice that were stained with VGluT1 and PSD95 antibodies at 12-week-old. Scale bar, 10 μm. (Right) Quantification of VGluT1/PSD95 co-localized puncta, normalized using the means of WT values in the ventral ACC layer 1. n = 5 (WT, 3 males and 2 females), 5 (LRRK2 G2019Ski/ki, 3 males and 2 females) mice, nested t-test, unpaired Two-tailed t-test. t (28) = 4.358, *p* = 0.0002. **d,** (Left) Representative images from the ventral ACC layer 2/3 of WT and LRRK2 G2019Ski/ki mice that were stained with VGluT1 and PSD95 antibodies at 12-week-old. Scale bar, 10 μm. (Right) Quantification of VGluT1/PSD95 co-localized puncta, normalized using the means of WT values in the ventral ACC layer 2/3. n = 5 (WT, 3 males and 2 females), 5 (LRRK2 G2019Ski/ki, 3 males and 2 females) mice, nested t-test, unpaired Two-tailed t-test. t (28) = 4.287, *p* = 0.0002. **e**, (Left) Representative images from MOp layer 1 of WT and LRRK2 G2019Ski/ki mice that were stained with VGAT and GEPHYRIN antibodies at 12-week-old. Scale bar, 10 μm. (Right) Quantification of VGAT/GEPHYRIN co-localized puncta, normalized using the means of WT values in MOp layer 1. n = 6 (WT, 3 males and 3 females), 6 (LRRK2 G2019Ski/ki, 3 males and 3 females) mice, nested t-test, unpaired Two-tailed t-test. t (34) = 7.164, *p* < 0.0001. **f**, (Left) Representative images from MOp layer 2/3 of WT and LRRK2 G2019Ski/ki mice that were stained with VGAT and GEPHYRIN antibodies at 12-week-old. Scale bar, 10 μm. (Right) Quantification of VGAT/GEPHYRIN co-localized puncta, normalized using the means of WT values in MOp layer 2/3. n = 6 (WT, 3 males and 3 females), 6 (LRRK2 G2019Ski/ki, 3 males and 3 females) mice, nested t-test, unpaired Two-tailed t-test. t (34) = 5.25, *p* < 0.0001. **g,** Representative mEPSC traces from the ventral ACC layer 2/3 pyramidal neurons in acute brain slices of WT and LRRK2 G2019Ski/ki mice. **h,** Cumulative frequency plots and quantification of synaptic event frequency, n = 15 (WT), 13 (LRRK2 G2019Ski/ki) neurons from 4 mice per genotype. Kolmogorov-Smirnov test (D = 0.504, *p* < 0.001). The average frequency of mEPSC in WT (2.521 ± 0.3846) and LRRK2 G2019Ski/ki (0.8691 ± 0.1309) mice. Unpaired Two-tailed t-test [t (26) = 3.828, *p* = 0.0007]. **i,** Cumulative frequency plots and quantification of synaptic event amplitude, n = 15 (WT), 13 (LRRK2 G2019Ski/ki) neurons from 4 mice per genotype. Kolmogorov-Smirnov test (D = 0.194, *p* < 0.0001). The average amplitude of mEPSC in WT (15.53 ± 0.8105) and LRRK2 G2019Ski/ki (13.52 ± 0.5818) mice. Unpaired t-test [t (26) = 1.951, *p* = 0.0619]. **j**, Representative mIPSC traces from MOp layer 2/3 pyramidal neurons in acute brain slices of WT and LRRK2 G2019Ski/ki mice. **k**, Cumulative frequency plots and quantification of synaptic event frequency, n = 12 (WT), 11 (LRRK2 G2019Ski/ki) neurons from 4 mice per genotype. Kolmogorov-Smirnov test (D = 0.424, *p* < 0.0001). The average frequency of mIPSC in WT (0.7606 ± 0.06816) and LRRK2 G2019Ski/ki (1.312 ± 0.1041) mice. Unpaired Two-tailed t-test [t (21) = 4.503, *p* = 0.0002]. **l**, Cumulative frequency plots and quantification of synaptic event amplitude, n = 12 (WT), 11 (LRRK2 G2019Ski/ki) neurons from 4 mice per genotype. Kolmogorov-Smirnov test (D = 0.382, *p* < 0.0001). The average amplitude of mIPSC in WT (8.776 ± 0.4961) and LRRK2 G2019Ski/ki (9.921 ± 0.5043) mice. Unpaired t-test [t (21) = 1.617, *p* = 0.1209]. Data are presented as mean ± s.e.m.

Synapse densities were quantified in the Layers 1 and 2/3 of the ACC and MOp of 12-week-old LRRK2 G2019Ski/ki and WT mice. There was a significant decrease (∼30%) in the VGluT1/PSD95-positive excitatory synapse densities in the ACC of the LRRK2 G2019Ski/ki mice compared to WT controls, whereas the VGAT/GEPHYRIN-positive inhibitory synapse numbers in the ACC were not different between genotypes (Fig. 3c-d; Extended Data Fig. 4a-b). On the other hand, we found no changes in the densities of VGluT1/PSD95-positive excitatory synapses in the Layers 1 and 2/3 of the MOp in LRRK2 G2019Ski/ki mice compared to WT controls (Extended Data Fig. 4c-d). However, compared to the 12-week-old WT controls, the density of VGAT/ GEPHYRIN-positive inhibitory synapses in Layer 1 and in Layer 2/3 of MOp of LRRK2 G2019Ski/ki mice were increased by ∼45% and ∼35%, respectively (Fig. 3e-f). These data indicate that LRRK2 G2019S mutation differentially impacts the excitatory and inhibitory synapse densities in the ACC and the MOp.

We next tested the effects of altered synapse density in the ACC and the MOp of LRRK2 G2019S mice on synaptic function using electrophysiology. To do so, we recorded miniature excitatory postsynaptic currents (mEPSCs) in the ACC and miniature inhibitory postsynaptic currents (mIPSCs) in the MOp layer 2/3 pyramidal neurons from acute brain slices of 12-week-old LRRK2 G2019Ski/ki and WT mice. In agreement with a reduction in excitatory synapse density in the ACC, LRRK2 G2019Ski/ki neurons displayed reduced mEPSC frequency by ∼65% and a corresponding right shift in the cumulative distributions of mEPSC inter-event intervals (Fig. 3g-h) when compared to WT neurons. There were no significant changes in the mean mEPSC amplitude or the cumulative probability between genotypes (Fig. 3i). mEPSC frequency changes correlate with changes in synapse numbers or the probability of presynaptic glutamate release148, whereas the mEPSC amplitude is an indicator of the synaptic strength reflecting the number of AMPARs at the synapse149. Therefore, together with our anatomical data, these physiological analyses reveal that LRRK2 G2019S reduced the number of intracortical excitatory connections made onto the Layer 2/3 pyramidal neurons in the ACC without a major change in the synaptic strength.

In the MOp motor cortex, on the other hand, we found a robust increase (∼73%) in mIPSC frequency when we recorded from the Layer 2/3 pyramidal neurons of the LRRK2 G2019Ski/ki mice compared with WT, with no significant change in the amplitude (Fig. 3j-l). The increased mIPSC frequency aligns with our findings that inhibitory synapse numbers are elevated in the MOp of the LRRK2 G2019S mice. This increase could be a result of enhanced inhibitory synaptogenesis or a local increase in the number of inhibitory interneurons in this brain region.

Altogether, these electrophysiological and neuroanatomical analyses show that LRRK2 G2019S reduces the density and the function of excitatory synaptic inputs made onto the ACC Layer 2/3 but increases the density and the function of inhibitory synaptic inputs made onto the MOp Layer 2/3. These data are in accordance with our finding that LRRK2 G2019S decreases excitatory synapse numbers in the ACC but increases inhibitory synapse numbers in the MOp. Furthermore, these results suggest that LRRK2 kinase function is critical to control proper excitatory and inhibitory synapse development and function in the cortex.

### Phospho-dead EZRIN rescues excitatory synapse density in the ACC of adult LRRK2 G2019Ski/ki mice

Because in LRRK2 G2019Ski/ki mice, all cell types, including astrocytes and neurons, express the mutant LRRK2, the cellular origin of the synaptic phenotypes is unclear. Moreover, if these synaptic phenotypes can be rescued by manipulating astrocytes in the adult brain is unknown. Given the robust effects of phospho-dead EZRIN on rescuing LRRK2 G2019S astrocyte morphology, we sought to test whether manipulating the balance of ERM phosphorylation in adult LRRK2 G2019S astrocytes can reverse the synaptic phenotypes we observed in the ACC or MOp of the LRRK2 G2019Ski/ki mice.

To do so, 9-week-old WT and LRRK2 G2019Ski/ki mice were retro-orbitally injected with AAVs to express Hemagglutinin (HA)-tagged WT EZRIN or phospho-dead EZRIN under the control of the astrocyte-specific GfaABC1D promoter (Extended Data Fig. 5a). The injected mouse brains were harvested at 12 weeks (3 weeks after injection) for synapse quantification, and electrophysiology (Extended Data Fig. 5a). The widespread viral expression of EZRIN proteins in ACC astrocytes was verified by staining with anti-HA tag antibody (Extended Data Fig. 5b). Overexpression of WT EZRIN in WT mouse brains did not cause a noticeable increase in phospho-ERM levels in the cortex. However, WT EZRIN overexpression was accompanied by intense phospho-ERM elevation in the LRRK2 G2019S(ki/ki) cortices. Whereas overexpression of the phospho-dead EZRIN eliminated the phospho-ERM elevation in the LRRK2 G2019Ski/ki cortex (Extended Data Fig. 5b). This observation indicates that overexpression of phospho-dead EZRIN suppresses the elevation of ERM phosphorylation in the LRRK2 G2019Ski/ki cortices.

Overexpression of WT EZRIN was not sufficient to rescue the excitatory synapse density decline in layer 1 and layer 2/3 ACC of the LRRK2 G2019Ski/ki mice. However, overexpression of phospho-dead EZRIN reduced excitatory synapse density in the WT background by around 30% (Fig. 4a-b). Strikingly, astrocytic overexpression of phospho-dead EZRIN in the LRRK2 G2019Ski/ki fully rescued the excitatory synapse numbers up to WT levels in ACC layer 1 and layer 2/3 (Fig. 4a-b). These data show that modulating the phosphorylation status of astrocytic ERMs through overexpression of the phospho-dead EZRIN in astrocytes is sufficient to generate synapse number deficits in WT mice, whereas in LRRK2 G2019Ski/ki mice, the same manipulation rescues synapse deficits. These data strongly suggest that the reduction we observed in synapse numbers in the ACC of the LRRK2 G2019Ski/ki mice is largely due to an astrocytic dysfunction caused by the imbalance of ERM phosphorylation. These results also indicate that astrocytes are crucial contributors to excitatory synaptic dysfunction in the LRRK2 G2019Ski/ki mouse cortex.

![Figure 4.](http://biorxiv.org/https://www.biorxiv.org/content/biorxiv/early/2023/04/10/2023.04.09.536178/F4.medium.gif)

[Figure 4.](http://biorxiv.org/content/early/2023/04/10/2023.04.09.536178/F4)

Figure 4. Overexpression of phospho-dead EZRIN in adult LRRK2 G2019Ski/ki astrocytes restores excitatory synapse number and function in the ventral ACC
**a,** Representative images from the ventral ACC layer 1 of WT and LRRK2 G2019Ski/ki mice injected with AAV-HA-tagged-WT EZRIN or AAV-HA-tagged-Phospho-dead EZRIN that were stained with VGluT1 and PSD95 antibodies at 12-week-old. Scale bar, 10 μm. Quantification of VGluT1/PSD95 co-localized puncta, normalized using the means of WT mice injected with AAV-HA-tagged-WT EZRIN in the ventral ACC layer 1. n = 6 (WT + WT EZRIN O/E, 3 males and 3 females), 5 (WT + Phospho-dead Ezrin O/E, 3 males and 2 females), 6 (LRRK2 G2019Ski/ki + WT EZRIN O/E, 3 males and 3 females), 6 (LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E, 3 males and 3 females) mice. One-way ANOVA [F (3, 19) = 5.882, *p* = 0.0051], Bonferroni’s multiple comparisons test revealed a significant difference between WT + WT EZRIN O/E and WT + Phospho-dead Ezrin O/E (*p* = 0.0493, 95% C.I. = [0.05586, 53.21]), between WT + WT EZRIN O/E and LRRK2 G2019Ski/ki + WT EZRIN O/E (*p* = 0.0269, 95% C.I. = [2.396, 53.08]), and between LRRK2 G2019Ski/ki + WT EZRIN O/E and LRRK2 G2019Ski/ki + Phospho-dead Ezrin O/E (*p* = 0.049, 95% C.I. = [-50.77, -0.08163]). There were no differences between WT + WT EZRIN O/E and LRRK2 G2019Ski/ki + Phospho-dead Ezrin O/E (*p* > 0.9999, 95% C.I. = [-23.03, 27.66]), between WT + Phospho-dead Ezrin O/E and LRRK2 G2019Ski/ki + WT EZRIN O/E (*p* > 0.9999, 95% C.I. = [-25.48, 27.68]), and between WT + Phospho-dead Ezrin O/E and LRRK2 G2019Ski/ki + Phospho-dead Ezrin O/E (*p* = 0.0863, 95% C.I. = [-50.90, 2.259]), alpha = 0.05. b, Representative images from the ventral ACC layer 2/3 of WT and LRRK2 G2019Ski/ki mice injected with AAV-HA-tagged-WT EZRIN or AAV-HA-tagged-Phospho-dead EZRIN that were stained with VGluT1 and PSD95 antibodies at 12-week-old. Scale bar, 10 μm. Quantification of VGluT1/PSD95 co-localized puncta, normalized using the means of WT mice injected with AAV-HA-tagged-WT EZRIN in the ventral ACC layer 2/3. n = 6 (WT + WT EZRIN O/E, 3 males and 3 females), 5 (WT + Phospho-dead EZRIN O/E, 3 males and 2 females), 6 (LRRK2 G2019Ski/ki + WT EZRIN O/E, 3 males and 3 females), 6 (LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E, 3 males and 3 females) mice. One-way ANOVA [F (3, 18) = 10.45, *p* = 0.0003], Bonferroni’s multiple comparisons test revealed a significant difference between WT + WT EZRIN O/E and WT + Phospho-dead Ezrin O/E (*p* = 0.0041, 95% C.I. = [8.857, 55.39]), between WT + WT EZRIN O/E and LRRK2 G2019Ski/ki + WT EZRIN O/E (*p* = 0.0016, 95% C.I. = [11.67, 56.22]), between WT + Phospho-dead EZRIN O/E and LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E (*p* = 0.0232, 95% C.I. = [-47.19.67, -2.636]) and between LRRK2 G2019Ski/ki + WT EZRIN O/E and LRRK2 G2019Ski/ki + Phospho-dead Ezrin O/E (*p* = 0.0092, 95% C.I. = [-47.97.77, -5.494]). There were no differences between WT + WT EZRIN O/E and LRRK2 G2019Ski/ki + Phospho-dead Ezrin O/E (*p* > 0.9999, 95% C.I. = [-15.06, 29.49]), and between WT + Phospho-dead Ezrin O/E and LRRK2 G2019Ski/ki + WT EZRIN O/E (*p* > 0.9999, 95% C.I. = [-20.45, 24.10]), alpha = 0.05. c, Representative mEPSC traces from the ventral ACC layer 2/3 pyramidal neurons in acute brain slices of WT and LRRK2 G2019Ski/ki mice injected with AAV-HA-tagged-WT EZRIN or AAV-HA-tagged-Phospho-dead EZRIN. d, Cumulative frequency plots and quantification of synaptic event frequency. n = 14 (WT + WT EZRIN O/E), 15 (WT + Phospho-dead EZRIN O/E), 11 (LRRK2 G2019Ski/ki + WT EZRIN O/E), 14 (LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E) neurons from 4 mice per condition. Kruskal-Wallis test [H (3) = 36.83, *p* < 0.0001]. Average frequency of mEPSC in WT + WT EZRIN O/E (1.555 ± 0.1125), WT + Phospho-dead EZRIN O/E (0.8416 ± 0.05145), LRRK2 G2019Ski/ki + WT EZRIN O/E (0.7154 ± 0.05959), and LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E (1.253 ± 0.04424) mice. The posthoc Dunn’s test with Bonferroni adjustments showed to be significant for WT + WT EZRIN O/E vs. WT + Phospho-dead EZRIN O/E (*p* < 0.0001), WT + WT EZRIN O/E vs. LRRK2 G2019Ski/ki + WT EZRIN O/E (*p* < 0.0001), WT + Phospho-dead EZRIN O/E vs. LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E (*p* = 0.0084), and LRRK2 G2019Ski/ki + WT EZRIN O/E vs. LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E (*p* = 0.0005). The posthoc Dunn’s test with Bonferroni adjustments revealed no significant difference between WT + WT EZRIN O/E and LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E (*p* > 0.9999) and between WT + Phospho-dead EZRIN O/E and LRRK2 G2019Ski/ki + WT EZRIN O/E (*p* > 0.9999). e, Cumulative frequency plots and quantification of synaptic event amplitude. n = 11 (WT + WT EZRIN O/E), 15 (WT + Phospho-dead EZRIN O/E), 11 (LRRK2 G2019Ski/ki + WT EZRIN O/E), 13 (LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E) neurons from 4 mice per condition. Kruskal-Wallis test [H (3) = 7.051, *p* = 0.0703]. Average amplitude of mEPSC in WT + WT EZRIN O/E (4.873 ± 0.1034), WT + Phospho-dead EZRIN O/E (6.339 ± 0.4284), LRRK2 G2019Ski/ki + WT EZRIN O/E (5.354 ± 0.2988), and LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E (5.591 ± 0.2247) mice. The posthoc Dunn’s test with Bonferroni adjustments revealed no significant difference for WT + WT EZRIN O/E vs. WT + Phospho-dead EZRIN O/E (*p* = 0.0688), WT + WT EZRIN O/E vs. LRRK2 G2019Ski/ki + WT EZRIN O/E (*p* > 0.9999), WT + Phospho-dead EZRIN O/E vs. LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E (*p* > 0.9999), and LRRK2 G2019Ski/ki + WT EZRIN O/E vs. LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E (*p* > 0.9999), WT + WT EZRIN O/E vs. LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E (*p* = 0.3605), and WT + Phospho-dead EZRIN O/E vs. LRRK2 G2019Ski/ki + WT EZRIN O/E (*p* = 0.9468). alpha = 0.05. Data are presented as mean ± s.e.m.

We next investigated whether the same manipulation of adult astrocytes can rescue the inhibitory synapse upregulation in the MOp. We found that neither the WT nor the phospho-dead EZRIN overexpression in adult astrocytes reduced the density of inhibitory synapses back to WT levels in the MOp layer 1 and layer 2/3 of the LRRK2 G2019Ski/ki mice (Extended Data Fig. 5c-d). These data suggest that overexpression of phospho-dead EZRIN in adult WT or LRRK2 G2019Ski/ki astrocytes is sufficient to modify the excitatory synapse numbers in the ACC but cannot restore or impair inhibitory synaptic connectivity changes seen in the MOp. It is plausible that LRRK2 G2019S impairs inhibitory synapses in the MOp by altering the number or connectivity of cortical interneurons through a developmental mechanism. Thus, manipulation in the adult is not sufficient to eliminate this phenotype. Future studies on the role of Lrrk2 in cortical development are likely to be beneficial in determining its role in controlling inhibition and how this control is disrupted in PD.

Because astrocytic overexpression of phospho-dead EZRIN impacted excitatory synapse numbers in the WT and LRRK2 G2019Ski/ki mice. Next, we performed whole cell patch clamp recordings from the ACC layer 2/3 pyramidal neurons of WT and LRRK2 G2019Ski/ki mice transduced with the same AAVs (Extended Data Fig. 5a. Overexpression of WT EZRIN in LRRK2 G2019Ski/ki astrocytes did not rescue the decreased frequency of mEPSCs in the ACC layer 2/3 neurons. However, astrocytic overexpression of the phospho-dead EZRIN significantly reduced the frequency of mEPSCs (reduced by ∼54%) in the WT ACC neurons but revamped the frequency of mEPSCs in the LRRK2 G2019Ski/ki ACC neurons (Fig. 4d). Similarly, the cumulative distribution analysis of mEPSCs showed that inter-event interval durations were significantly impacted by astrocytic phospho-dead EZRIN expression in both genotypes in opposite directions (Fig. 4d). In contrast, no significant differences were observed in the mean mEPSC amplitudes across all 4 conditions using posthoc comparisons (Fig. 4e).

Together, our results reveal that astrocytic overexpression of phospho-dead EZRIN in adult LRRK2 G2019Ski/ki mice can recover the excitatory synapse density and function, whereas the same manipulation disrupts synapse numbers and function in WT ACC neurons. These findings show that the balance of ERM phosphorylation status in astrocytes is crucial for maintaining excitatory synapse density and function in the ACC. This work also reveals a causal link between the astrocytic and synaptic dysfunction induced by the LRRK2 G2019S mutation, providing a non-cell autonomous mechanism for rescuing aberrant cortical wiring in PD pathogenesis.

In summary, here we describe a previously unknown role for Lrrk2, a PD-linked gene, in controlling astrocyte morphology and astrocyte-mediated synaptogenic function. Lrrk2 is needed for establishing astrocyte morphological complexity through the phosphorylation of ERMs. LRRK2 G2019S mutation, which increases ERM phosphorylation in astrocytes, also impaired astrocyte morphogenesis *in vitro* and *in vivo*. These findings indicate that ERM phosphorylation balance is critical for the acquisition of complex astrocyte morphology. EZRIN and other ERM proteins are known to interact with cytoskeletal proteins such as F-actin119 and control the dynamics of F-actin polymerization in a phosphorylation-dependent manner120. Future studies investigating how phosphorylated and unphosphorylated states of EZRIN control astrocyte morphogenesis through modulation of the cytoskeleton will be helpful in deciphering mechanisms of astrocyte morphogenesis.

LRRK2 G2019Ski/ki mice do not recapitulate cardinal motor symptoms of PD because there is no detectable dopaminergic neuron loss in these mice67–69. LRRK2 mutation carriers show non-motor symptoms in comparison to non-carriers, such as hyposmia and decreased cognitive performance150,41, 151, 152. These non-motor symptoms arise long before motor dysfunction in PD, indicating that the aberrant synaptic connectivity within multiple brain circuits is present long before the death of the dopaminergic neurons40–43. We reasoned that LRRK2 G2019Ski/ki mice may display early circuit dysfunction akin to the non-motor symptoms of prodromal PD. In agreement with this possibility, previous studies showed that LRRK2 G2019Ski/ki mice have deficits in attention and goal-directed learning and differential response to stress74–76, 153. Our findings showing synaptic deficits in the ACC of LRRK2 G2019Ski/ki mice fit well with these studies because the ACC is a brain region that controls attention, goal-directed actions, and mood154–159.

We observed synaptic deficits in the ACC of LRRK2 G2019Ski/ki mice concurrently with enhanced ERM phosphorylation in astrocytes. Remarkably, overexpression of the phospho-dead EZRIN in the astrocytes of 9-week-old mice can restore the excitatory synapse numbers and function in the ACC layer 2/3 neurons from 12-week-old mice. This result causally links astrocyte dysfunction to the cortical synaptic dysfunction in the LRRK2 G2019Ski/ki mice. Moreover, our findings indicate that restoring astrocyte function, even after development is completed, can be used to treat excitatory synaptic pathology. Future work aimed at understanding the molecular underpinnings of how LRRK2 mutations alter synaptogenic functions of astrocytes may lead to effective strategies to treat PD.

How does ERM phosphorylation control both the structure and the synaptogenic functions of astrocytes? Astrocytes control synapse formation and function both through cell adhesion and secreted proteins that signal to neurons31, 160. The canonical function of ERM proteins is linking the actin cytoskeleton with the plasma membrane, thus allowing cellular process outgrowth and morphogenesis161–163. Less is known about the roles of ERM in the secretion process. However, it is plausible that ERM phosphorylation regulates synaptogenic protein secretion from astrocytes independent of its roles in astrocyte morphology. Another alternative explanation is a role for astrocytic phospho-ERM proteins in controlling synapse elimination by astrocytes. In agreement with this possibility, a recent study found that synapses are more likely to be eliminated if phospho-ERM proteins were localized to peri-synaptic astrocyte processes in ALS patient brains and mouse models164. Future studies investigating LRRK2 and ERM interactomes in astrocytes will help uncover the molecular pathways involved in LRRK2-ERM signaling at the tripartite synapse.

In summary, our findings reveal a critical function for LRRK2 in astrocyte development and how LRRK2 G2019S mutation derails important roles of astrocytes in maintaining synaptic connectivity in the developing and mature cortex. Furthermore, here we pinpoint the regulation of astrocytic ERM phosphorylation as a molecular mechanism that is impaired when LRRK2 G2019S mutation is present in astrocytes. These findings suggest that LRRK2-mediated ERM phosphorylation is an early mediator of PD pathogenesis in astrocytes and that astrocytes can be directly responsible for synaptic dysfunction seen in the early stages of PD.

## METHODS

### Animals

All mice and rats were used in accordance with the Institutional Animal Care and Use Committee (IACUC) and the Duke Division of Laboratory Animal Resources (DLAR) oversight (IACUC Protocol Numbers A147-17-06 and A117-20-05). All mice and rats were housed under typical day/night conditions of 12-hour cycles. LRRK2 G2019Ski/ki mice (RRID: IMSR\_TAC:13940) were obtained through Taconic. Aldh1l1-EGFP (RRID: MMRRC_011015-UCD) mice were obtained through MMRRC. Wild-type CD1 mice used for PALE were purchased through Charles River Laboratories (RRID: IMSR_CRL:022). LRRK2 G2019S-BAC Transgenic rats (RRID: IMSR_TAC:10681) were obtained through Taconic. LRRK2 knock-out rats (RRID: RGD_7241056) were obtained through SAGE Labs, Inc. in St. Louis, MO.

Mice and rats were used for experiments as specified in the text and figure legends. For all experiments, age, and sex-matched mice were randomly assigned to experimental groups based on genotypes. For MLi-2 treatment of astrocytes, only female rat astrocyte cultures were used for Western blot and analysis because male rat astrocyte cultures have low phospho-ERM levels *in vitro*. For other experiments, mice of both sexes were included in the analysis, and we did not observe any influence or association of sex on the experimental outcomes.

### Primary cortical neuron isolation and culture

Purified (glia-free) rat cortical neurons were prepared as described previously28. Briefly, cortices from P1 rat pups of both sexes (Sprague Dawley, Charles River Laboratories, SD-001) were micro-dissected, digested in papain (∼7.5 units/ml) at 33°C for 45 minutes, triturated in low and high ovomucoid solutions, resuspended in panning buffer (DPBS (GIBCO 14287) supplemented with BSA and insulin) and passed through a 20 μm mesh filter (Elko Filtering 03-20/14). Filtered cells were incubated on negative panning dishes coated with Bandeiraea Simplicifolia Lectin 1 (x2), followed by goat anti-mouse IgG+IgM (H+L) (Jackson ImmunoResearch 115-005-044), and goat anti-rat IgG+IgM (H+L) (Jackson ImmunoResearch 112-005-044) antibodies, then incubated on positive panning dishes coated with mouse anti-L1 (ASCS4, Developmental Studies Hybridoma Bank, Univ. Iowa) to bind cortical neurons. Adherent cells were collected by forceful pipetting with a P1000 pipette. Isolated neurons were pelleted (11 minutes at 200 g) and resuspended in serum-free neuron growth media (NGM; Neurobasal, B27 supplement, 2 mM L-Glutamine, 100 U/ml Pen/Strep, 1 mM sodium pyruvate, 4.2 μg/ml Forskolin, 50 ng/mL BDNF, and 10 ng/mL CNTF). 70,000 neurons were plated onto 12 mm glass coverslips coated with 10 μg/ml poly-D-lysine (PDL, Sigma P6407) and 2 μg/ml laminin and incubated at 37°C in 10% CO2. On day *in-vitro* (DIV) 2, half of the media was replaced with NGM Plus (Neurobasal Plus, B27 Plus, 100 U/mL Pen/Strep, 1 mM sodium pyruvate, 4.2 μg/ml Forskolin, 50 ng/ml, BDNF, and 10 ng/ml CNTF) and AraC (10 μM) was added to stop the growth of proliferating contaminating cells. On DIV 3, all the media was replaced with NGM Plus. In experiments involving lentivirus infection, 100 μl of supernatant containing lentivirus plus polybrene (1 μg/ml) was added to the AraC NGM mixture on DIV 2 and completely washed out on DIV 3 and replaced with NGM Plus containing 100 ng/ml BDNF. Neurons were fed on DIV 6 and DIV 9 by replacing half of the media with NGM Plus.

### Primary cortical astrocyte isolation and culture

Rat cortical astrocytes were prepared as described previously28. P1 rat cortices from both sexes were micro-dissected, papain digested, triturated in low and high ovomucoid solutions, and resuspended in astrocyte growth media (AGM: DMEM (GIBCO 11960), 10% FBS, 10 μM, hydrocortisone, 100 U/ml Pen/Strep, 2 mM L-Glutamine, 5 μg/ml Insulin, 1 mM Na Pyruvate, 5 μg/ml N-Acetyl-L-cysteine). Between 15-20 million cells were plated on 75 mm2 flasks (non-ventilated cap) coated with poly-D-lysine and incubated at 37°C in 10% CO2. On DIV 3, the removal of non-astrocyte cells was performed by forcefully shaking closed flasks by hand for 10-15 s until only an adherent monolayer of astrocytes remained. AraC was added to the media from DIV 5 to DIV 7 to eliminate contaminating fibroblasts. On DIV 7, astrocytes were trypsinized (0.05% Trypsin-EDTA) and plated into 12-well or 6-well dishes. On DIV 8, cultured rat astrocytes were transfected with shRNA and/or expression plasmids using Lipofectamine LTX with Plus Reagent (Thermo Scientific) per the manufacturer’s protocol. Briefly, 1 μg (12-well) or 2 μg (6-well) total DNA was diluted in Opti-MEM containing Plus Reagent, mixed with Opti-MEM containing LTX (1:2 DNA to LTX), and incubated for 30 minutes. The transfection solution was added to astrocyte cultures and incubated at 37°C for 3 hours. On DIV 10, astrocytes were trypsinized, resuspended in NGM plus, plated (20,000 cells per well) onto DIV 10 neurons, and co-cultured for 48 hours.

### shRNA plasmids

pLKO.1 Puro plasmids containing shRNA (pLKO.1-shRNA) against mouse/rat *Lrrk2* (sh*Lrrk2*: TRCN0000322193; GGCCGAGTTGTGGATCATATT), was obtained from the RNAi Consortium (TRC) via Dharmacon. A scrambled shRNA sequence was generated (GTTGCTGAATGGCGGATCTAT) and cloned into the pLKO.1 TRC cloning vector165 according to Addgene protocols ([https://www.addgene.org/protocols/plko/](https://www.addgene.org/protocols/plko/)). To generate pLKO.1 shRNA plasmids that express EGFP (pLKO.1-shRNA-EGFP), CAG-EGFP was removed from pLenLox-shNL1-CAG-EGFP166 and inserted between Kpn1 and SpeI sites in pLKO.1 Puro, replacing the puromycin resistance gene. pLKO.1 shRNA mCherry plasmids were generated by replacing EGFP with mCherry between KpnI and NheI sites.

### PiggyBac plasmids

pPB-CAG-EGFP and pGLAST-PBase were a gift from Dr. Joseph Loturco167. To generate pPB-CAG-mCherry-CAAX, mCherry-CAAX was inserted between XmaI and NotI restrictions sites to replace EGFP. To insert the hU6 promoter and shRNA in pPB-CAG-mCherry-CAAX, a DNA fragment containing hU6 and shRNA was amplified from pLKO.1-shRNA using Phusion High-Fidelity DNA Polymerase (NEB) with primers that introduced SpeI restriction sites (Forward Primer: GGACTAGTCAGGCCCGAAGGAATAGAAG; Reverse Primer: GGACTAGTGCCAAAGTGGATCTCTGCTG). PCR products were purified, digested with SpeI, and ligated into pPBCAG-mCherry-CAAX at the SpeI restriction site. An analytical digest with EcoRI followed by sequencing was used to confirm the orientation of the inserted DNA fragment.

### Ezrin plasmids

pZac2.1-GfaABC1D-Lck-GCaMP6f was a gift from Dr. Baljit Khakh (Addgene plasmid #52924). pZac2.1-GfaABC1D-BioID2-HA was generated by PCR of BioID2 from pAAV-hSyn-BioID2-Linker-Synapsin1a-HA168 (primers Fw: 5’-ctagcctcgagaattcaccatgttcaaaaatcttatttg-3’, Rv: 5’-ccgggtcgactctagatgcgtaatccggtacatcg-3’) and insertion into the EcoRI and XbaI restriction sites of pZac2.1-GfaABC1D-Lck-GCaMP6f using In-Fusion cloning (TaKaRa). pHJ421(pEGFP-Ezrin WT) and pHJ423 (pEGFP-Ezrin T567D) were a gift from Stephen Shaw (Addgene plasmid # 20680 and # 20681). pZac2.1-GfaABC1D-Ezrin WT-BioID2-HA and pZac2.1-GfaABC1D-Ezrin T567D-BioID2-HA were generated by PCR of Ezrin from pHJ421 or pHJ423 (primers Fw: 5’-ctagcctcgagaattcaccatgccgaaaccaatca-3’, Rv: 5’-tgaacatggtgaattccgacagggcctcgaactcg-3’) and insertion into the EcoRI restriction sites of pZac2.1-GfaABC1D-BioID2, respectively. To generate pZac2.1-GfaABC1D-Ezrin T567A-BioID2-HA plasmid, Q5® Site-Directed Mutagenesis Kit (NEB) was used with mutagenesis primers (Fwd: CAAGTACAAGGCGCTGCGGCAGA; Rev: TCCCGGCCTTGCCTCATG)

### Lentivirus production and transduction

Lentiviruses containing shRNA targeting vectors were produced to test the knockdown efficiency of shRNA constructs in cultured primary astrocytes or to bulk transduce neurons with shRNA and GFP. To produce lentivirus, HEK293T cells were transfected with a pLKO.1 shRNA Puro targeting plasmid (for astrocyte transduction), an envelope plasmid (VSVG), and a packaging plasmid (dR8.91) using X-tremeGENE (Roche). One day after transfection, the media was replaced with AGM (for astrocyte transduction), and media containing lentivirus was collected on days 2 and 3 post-transfection. To assess the knockdown efficiency of shRNAs in astrocytes, rat primary astrocytes at DIV 7 were plated in 6-well dishes in 2 ml of AGM. On DIV 8, 1 ml of AGM was removed, and 500 μl of fresh AGM was added along with 500 μl of lentivirus-containing media and 1 μg/ml polybrene. Cultured astrocytes were treated with puromycin (1 μg/ml) from DIV 10-15 to select for transduced cells. Cultured astrocytes were lysed at DIV 15 for protein extraction and Western blot analysis.

### MLi-2 treatment of astrocytes

Cortical astrocytes were isolated from P0-P1 rat female pups as described in the “Cortical astrocyte isolation and culture” section. Cultured astrocytes were treated with 0, 30, and 100 nM LRRK2 kinase inhibitor, MLi-2 (Tocris; Catalog number: 5756), for 72 hours. Cultured astrocytes were lysed at DIV 11 for protein extraction and Western blot analysis.

### Protein extraction and Western blotting

Protein was extracted from cultured rat astrocytes using membrane solubilization buffer (25 mM Tris pH 7.4, 150 mM NaCl, 1 mM CaCl2, 1 mM MgCl2, 0.5% NP-40, and protease inhibitors). Cultured astrocytes were washed twice with ice-cold TBS containing 1 mM CaCl2 and 1 mM MgCl2 and incubated on ice in membrane solubilization buffer for 20 minutes with occasional agitation. Cell lysates were collected, vortexed briefly, and centrifuged at 4°C at high speed for 10 minutes to pellet non-solubilized material. The supernatant was collected and stored at −80°C.

Pierce BSA Protein Assay Kit (Thermo Fisher) was used to determine protein concentration, and lysates were mixed with 4× Pierce™ Reducing Sample Buffer (Thermo Scientific) and incubated at 45°C for 45 minutes to denature proteins. 7-10 μg (cultured astrocyte lysates) of protein was loaded into Bolt™ 4–12% Bus-Tris Plus gels (Thermo Scientific) and run at 150 V for 1 hour. Proteins were transferred at 100 V to PVDF membrane (Millipore) for 1.5 hours, blocked in 5% BSA in TBST (137 mM NaCl, 2.68 mM KCl, 24.7 mM Tris-Base, 0.1% (w/v) Tween 20) for 1 hour and incubated in primary antibodies overnight at 4°C. Primary antibodies used were: anti-LRRK2 (Rabbit, 1:500; ab133474, abcam), GAPDH (mouse, 1:5000; ab8245, abcam), β-actin (mouse, 1:5000; A5441, Millipore Sigma), phospho-ERM (Rabbit, 1:500; #3141, Cell Signaling), ERM (Rabbit, 1:500; #3142, Cell Signaling), phospho-Rab10 (Rabbit, 1:500; ab230261, abcam), Rab10 (Rabbit, 1:500; ab237703, abcam). The next day, membranes were washed with TBST, incubated in HRP secondary antibodies (Thermo Fisher Scientific) for 2 hours, washed in TBST, and imaged on a Biorad Gel Doc imaging system. Protein levels were quantified using FIJI.

### Immunocytochemistry

Astrocyte-neuron co-cultures on glass coverslips were fixed on DIV 12 with warm 4% PFA for 7 minutes, washed 3 times with PBS, blocked in a blocking buffer containing 50% normal goat serum (NGS) and 0.4% Triton X-100 for 30 minutes, and washed in PBS. Samples were then incubated overnight at 4°C in primary antibodies diluted in blocking buffer containing 10% NGS, washed with PBS, incubated in Alexa Fluor conjugated secondary antibodies (Life Technologies) for 2 hours at room temperature, and washed again in PBS. Coverslips were mounted onto glass slides (VWR Scientific) with Vectashield mounting media containing DAPI (Vector Labs), sealed with nail polish, and imaged on an AxioImager M1 (Zeiss) fluorescence microscope. Images of healthy astrocytes with strong expression of fluorescent markers that did not overlap with other fluorescent astrocytes were acquired at 40× magnification in red, green, and/or DAPI channels using a CCD camera. Astrocyte morphological complexity was analyzed in FIJI using the Sholl analysis plugin169, as described previously28 ([https://github.com/Eroglu-Lab/In-Vitro-Sholl](https://github.com/Eroglu-Lab/In-Vitro-Sholl)). Statistical analyses were conducted using a custom code in R ([https://github.com/Eroglu-Lab/In-Vitro-Sholl](https://github.com/Eroglu-Lab/In-Vitro-Sholl)). A mixed-effect model with multiple comparisons made using the Tukey post-test was used for Sholl analysis to account for the variability per experiment as a random effect to evaluate differences between the conditions. The exact number of independent experiments and the exact number of cells analyzed are indicated in the figure legend for each experiment. To ensure the health of astrocyte-neuron co-cultures, the peak for the number of astrocyte intersections must be greater than or equal to 25 in the control condition. We imaged non-overlapping astrocytes that contained a single nucleus (DAPI stain) and expressed consistent fluorescent markers and EZRIN constructs according to the experimental conditions.

### Postnatal astrocyte labeling by electroporation (PALE)

Late P0/early P1 mice were sedated by hypothermia until anesthetized, and 1 μl of plasmid DNA mixed with Fast Green Dye was injected into the lateral ventricle of one hemisphere using a pulled glass pipette (Drummond). For shRNA knockdown experiments in wild-type CD1 mice, the 1 μl of DNA contained 1 μg of pGLAST-PBase and 1 μg of pPB-shRNA-mCherryCAAX was injected. To label astrocytes in WT and LRRK2 G2019Ski/ki mice, the 1 μl of DNA contained 1 μg of pGLAST-PBase and 1 μg of pPB-mCherry-CAAX was injected per mouse.

For PALE-mediated overexpression of phospho-mimetic EZRIN in shRNA knockdown experiments, 0.5 μg pGLAST-PBase, 0.5 μg pPB-shRNA-mCherryCAAX, and 1 μg pZac2.1-GfaABC1D-Ezrin T567D-BioID2-HA were injected in a total volume of 1 μl. For phospho-dead EZRIN overexpression in WT and LRRK2 G2019Ski/ki mice, 0.5 μg pGLAST-PBase, 0.5 μg of pZac2.1-gfaABC1D-mCherry-CAAX and 1 μg of pZac2.1-GfaABC1D-Ezrin T567A-BioID2-HA were injected in a total volume of 1 μl. Following DNA injection, electrodes were oriented with the positive terminal above the frontal cortex and the negative terminal below the chin, and 5 discrete 50 ms pulses of 100 V spaced 950 ms apart were applied. Pups were recovered on a heating pad, returned to their home cage, and monitored until collection at P21. The number of mice used for each experiment is indicated in the figure legends. All animals appeared healthy at the time of collection. Brain sections were examined for the presence of electroporated cells before staining.

### Adeno-associated virus (AAV) production and administration

Purified AAVs were produced as described previously170. Briefly, HEK293T cells were transfected with pAd-DELTA F6, serotype plasmid AAV PHP.eB, and AAV plasmid (pZac2.1-GfaABC1D-Ezrin-BioID2-HA or pZac2.1-GfaABC1D-Ezrin T567A-BioID2-HA). Three days after transfection, cells were collected in 15 mM NaCl, 5 mM Tris-HCl, pH 8.5, and lysed with repeat freeze-thaw cycles followed by treatment with Benzonase (Novagen 70664) at 37°C for 30 minutes. Lysed cells were pelleted by centrifugation, and the supernatant, containing AAVs, was applied to an Optiprep density gradient (Sigma D1556, 15%, 25%, 40%, and 60%) and centrifuged at 67,000 rpm using a Beckman Ti-70 rotor for 1 hour. The AAV-enriched fraction was isolated from between 40% and 60% iodixanol solution and concentrated by repeated washes with sterile PBS in an Amicon Ultra-15 filtration unit (NMWL: 100 kDa, Millipore UFC910008) to a final volume of ∼100 μl and aliquoted for storage at −80°C. 9-week-old WT or LRRK2 G2019Ski/ki mice placed in a stereotaxic frame were anesthetized through inhalation of 1.5% isofluorane gas. 10 μl of purified AAVs having a titer of ∼1 × 1012 GC/ml was introduced into the mouse brain intravenously by injection into the retro-orbital sinus. After 3 weeks at 12-week-old, mice were anesthetized with 200 mg/kg Tribromoethanol (Avertin) and transcardially perfused with TBS/Heparin and 4% paraformaldehyde (PFA) at room temperature (RT). Harvested brains were post-fixed overnight in 4% PFA, cryoprotected in 30% sucrose, and the brain blocks were prepared with O.C.T. (TissueTek) to store at −80°C. 30 µm thick brain sections were obtained through cryosectioning using a Leica CM3050S (Leica, Germany) vibratome and stored in a mixture of TBS and glycerol at −20°C for further free-float antibody staining procedures.

### Immunohistochemistry on mouse brain sections

Mice used for immunohistochemistry were anesthetized with 200 mg/kg Avertin and perfused with TBS/Heparin and 4% PFA. Brains were collected and post-fixed in 4% PFA overnight, cryoprotected in 30% sucrose, frozen in a solution containing 2 parts 30% sucrose and 1-part O.C.T. (TissueTek), and stored at −80°C. Floating coronal tissue sections of 30 μm, 40 μm or 100 μm thickness were collected and stored in a 1:1 mixture of TBS/glycerol at −20°C. For immunostaining, sections were washed in 1× TBS containing 0.2% Triton X-100 (TBST), blocked in 10% NGS diluted in TBST, and incubated in primary antibody for 2-3 nights at 4°C with gentle shaking. Primary antibodies used were anti-LRRK2 (Rabbit, 1:500; ab133474, Abcam), phospho-ERM (Rabbit, 1:500; #3141, Cell Signaling), Sox9 (Rabbit, 1:500; AB5535, Millipore), GFAP (Rabbit, 1:500; Z0334, Agilent DAKO), VGluT1 (Guinea pig, 1:2000; 135304, Synaptic Systems), PSD95 (Rabbit, 1:300; 51-6900, Invitrogen), VGAT (Guinea pig, 1:1000; 131004, Synaptic Systems), and GEHPYRIN (Rabbit, 1:1000; #14304S, Cell Signaling). Following the primary incubation, sections were washed in TBST, incubated in Alexa Fluor conjugated secondary antibodies diluted 1:200 (Life Technologies) for 2-3 hours at room temperature, washed with TBST, and mounted onto glass slides using a homemade mounting media (90% Glycerol, 20 mM Tris pH 8.0, 0.5% n-Propyl gallate) and sealed with nail polish. For DAPI staining, DAPI (1:50,000) was added to the secondary antibody solution for the final 10 minutes of incubation. Images were acquired with an Olympus FV 3000 microscope.

### Mouse astrocyte territory volume analysis

To assess the territory volume of individual astrocytes in the mouse cortex, 100 μm-thick floating sections containing anterior cingulate cortex (ACC) and primary motor cortex (MOp) astrocytes labeled sparsely via PALE with mCherry-CAAX were collected. High-magnification images containing an entire astrocyte (50-60 μm z-stack) were acquired with an Olympus FV 3000 microscope with the 60× objective. Criteria for data inclusion required that the entirety of the astrocyte could be captured within a single brain section and that the astrocyte was in layer 2/3 of the ACC or MOp. Astrocytes in which the entire astrocyte could not be captured within the section or was in other layers or outside of the ACC or MOp were not imaged. Imaged astrocytes were analyzed using Imaris Bitplane software as described previously28. Briefly, surface reconstructions were generated, and the Imaris Xtensions “Visualize Surface Spots” and “Convex Hull” were used to create an additional surface render representing the territory of the astrocyte. The volume of each territory was recorded, and astrocyte territory sizes from biological replicates were analyzed across experimental conditions using a nested two-way ANOVA followed by Bonferroni posthoc test. For 3D Sholl analysis of individual PALE astrocytes, we first loaded images onto Imaris and then created a surface. After generating the surface of astrocytes, we created filaments using ‘Add new filament (leaf icon)’. For the quantification of complexity, we clicked on the gear tool on Imaris to display Sholl intersections. The number of animals and cells/animals analyzed are specified in the figure legend for each experiment.

### Mouse synapse imaging and analysis

Staining, image acquisition, and analysis of synaptic density were performed as described previously28, 171 with slight adjustments. Synaptic staining was performed in coronal sections (30 μm thick) containing the ACC and MOp from WT and LRRK2 G2019Ski/ki mice. To label pre and postsynaptic proteins, the following antibody combinations were used: VGluT1 and PSD95 (excitatory, intracortical), VGAT, and GEPHYRIN (inhibitory). High magnification 60× objective plus 1.64x optical zoom z-stack images containing 15 optical sections spaced 0.34 μm apart were obtained using an Olympus FV 3000 inverted confocal microscope. Each z-stack was converted into 5 maximum projection images (MPI), each corresponding to a 1 μm section of z plane, by using FIJI. Synapses were identified by the colocalization of pre and postsynaptic puncta. The number of co-localized synaptic puncta of excitatory intracortical (VGluT1/PSD95) and inhibitory (VGAT/GEPHYRIN) synapses were obtained using the FIJI plugin Puncta Analyzer147. 15 MPIs were analyzed for each mouse (5 MPI/tissue section, 3 tissue sections/mouse). Between 4 and 5, age and sex-matched mice/genotype/condition were analyzed for each synaptic staining combination, as indicated in the figure legends. All animals appeared healthy at the time of collection. No data were excluded.

### Cell counting, imaging, and analysis

Tile scan images containing the anterior cingulated cortex (ACC) and primary motor cortex (MOp) from P21 WT and LRRK2 G2019Ski/ki; Aldh1l1-eGFP mice were acquired on a confocal Leica SP8 STED microscope using the galvo scanner and 20× objective. For ALDH1L1-EGFP and SOX9 double positive cell counting in the ACC and MOp, the cells labeled with ALDH1L1-EGFP and SOX9 were counted by hand using the cell counter tool in FIJI. 2-4 sections per brain from 3 sex and age-matched mice/genotype were analyzed.

### Human brain section staining

Floating human frontal cortex sections of 40 μm thickness were obtained from Banner Sun Health Research Institute in Sun City, Arizona (4 control and 3 LRRK2 G2019S mutation carrier subjects). None of the control subjects had a history of dementia or neurological or psychiatric disorders at the time of death (See Supplemental Table 1). Informed and written consent was obtained from the donors. For immunostaining, sections were washed in 1× TBS containing 0.3% Triton X-100 (TBST), blocked in 3% NGS diluted in TBST, and incubated in primary antibody 2-3 nights at 4°C with shaking. Primary antibodies used were GFAP (chicken, 1:250; AB5541, Millipore Sigma) and phospho-ERM (Rabbit, 1:250; #3726, Cell Signaling). Following primary incubation, sections were washed in TBST, incubated in Alexa Fluor conjugated secondary antibodies diluted 1:200 (Life Technologies) for 2-3 hours at room temperature, washed with TBST, and mounted onto glass slides using a homemade mounting media (90% Glycerol, 20 mM Tris pH 8.0, 0.5% n-Propyl gallate) and sealed with nail polish.

### Mouse brain slice electrophysiology

For whole-cell patch-clamp recordings, 3-4 mice of each genotype and condition were used for miniature excitatory postsynaptic current (mEPSC) and miniature inhibitory postsynaptic current (mIPSC) measurements. WT and *LRRK2* G2019Ski/ki mice of both sexes were anesthetized with 200 mg/kg tribromoethanol (avertin) and decapitated. After decapitation, the brains were immersed in ice-cold artificial cerebrospinal fluid (aCSF, in mM): 125 NaCl, 2.5 KCl, 3 mM MgCl2, 0.1 mM CaCl2, 10 glucose, 25 NaHCO3, 1.25 NaHPO4, 0.4 L-ascorbic acid, and 2 Na-pyruvate, pH 7.3-7.4 (310 mOsmol). 350 μm thick coronal slices containing the ACC were obtained using a vibrating tissue slicer (Leica VT1200; Leica Biosystems). Slices were immediately transferred to standard aCSF (33°C, continuously bubbled with 95% O2 – 5% CO2) containing the same as the low-calcium aCSF but with 1 mM MgCl2 and 1-2 mM CaCl2. After 30-minute incubation at 33°C, slices were transferred to a holding chamber with the same extracellular buffer at room temperature (RT: ∼25°C). Brain slices were visualized by an upright microscope (BX61WI, Olympus) through a 40× water-immersion objective equipped with infrared-differential interference contrast optics in combination with a digital camera (ODA-IR2000WCTRL). Patch-clamp recordings were performed by using an EPC 10 patch-clamp amplifier, controlled by Patchmaster Software (HEKA). Data were acquired at a sampling rate of 50 kHz and low-pass filtered at 6 kHz.

To measure mEPSCs, the internal solution contained the following (in mM): 125 K-gluconate, 10 NaCl, 10 HEPES, 0.2 EGTA, 4.5 MgATP, 0.3 NaGTP, and 10 Na-phosphocreatine, pH adjusted to 7.2 – 7.4 with KOH and osmolality set to ∼ 300 mOsmol. mEPSCs were measured in the aCSF bath solution containing 1 µM tetrodotoxin and 50 µM Picrotoxin at -70 mV in voltage-clamp mode. To measure mIPSCs, the internal solution contained the following (in mM): 77 K-gluconate, 77 KCl, 10 HEPES, 0.2 EGTA, 4.5 MgATP, 0.3 NaGTP, and 10 Na-phosphocreatine, pH adjusted to 7.2 – 7.4 with KOH and osmolality set to ∼ 300 mOsmol. mIPSCs were measured in the aCSF bath solution containing 1 µM tetrodotoxin and 10 µM 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX), and 50 µM D-2-amino-5-phosphonopentanoate (D-AP5) at -70 mV in voltage-clamp mode. mEPSCs and mIPSCs recorded at -70 mV were detected using Minhee Analysis software ([https://github.com/parkgilbong/Minhee\_Analysis_Pack](https://github.com/parkgilbong/Minhee_Analysis_Pack)). To analyze the frequency, events were counted over 5 minutes of recording. To obtain the average events for each cell, at least 100 non-overlapping events were detected and averaged. The peak amplitude of the average mEPSCs was measured relative to the baseline current.

### Quantification and statistical analysis

All statistical analyses were performed in GraphPad Prism 9. Exact value of n, what n represents, and specific statistical tests for each experiment are indicated in the figure legend for each experiment. All data are represented as mean ± standard error of the mean, and data points are shown where applicable. Exact *P*-values are listed in the figure for each experiment. Where indicated, the unpaired two-tailed t-tests were run using Welch’s correction, and a correction for multiple comparisons was applied using Hom-Sidak method with an alpha threshold of 0.05 for adjusted *P*-value. A Geisser-Greenhouse correction was used for both One-way and Two-way ANOVA analyses. For Sholl analysis, statistical analyses were conducted using a custom code in R ([https://github.com/Eroglu-Lab/In-Vitro-Sholl](https://github.com/Eroglu-Lab/In-Vitro-Sholl)). A mixed-effect model with multiple comparisons made using the Tukey post-test was used for Sholl analysis to account for the variability per experiment as a random effect to evaluate differences between the conditions. Sample sizes were determined based on previous experience for each experiment to yield high power to detect specific effects. No statistical methods were used to predetermine the sample size. All experimental animals that appeared healthy at the time of tissue collection were processed for data collection.

## Supporting information

Supplemental Table 1 [[supplements/536178_file04.xlsx]](pending:yes)

## IP rights notice

This article is subject to HHMI’s Open Access to Publications policy. HHMI lab heads have previously granted a nonexclusive CC BY 4.0 license to the public and a sublicensable license to HHMI in their research articles. Pursuant to those licenses, the author-accepted manuscript of this article can be made freely available under a CC BY 4.0 license immediately upon publication.

## Author contributions

Conceptualization, SW, ARLS, and CE; Methodology, SW, DSB, CXT, TT, MPR, KD, SHS, and CE; Investigation, SW, DSB, CXT, KD; Formal analysis, SW, CXT, and MPR; Resources, KS; Writing – original draft, SW and CE; Writing – Review & Editing, SW, SHS, CXT, TT, MPR, KD, KS, ARLS, DSB, and CE; Funding Acquisition, SW, SHS, ARLS, and CE.

## Declaration of interests

The authors declare no competing interests.

## Data Availability

The data that support the findings of this study are available from the corresponding author (Dr. Cagla Eroglu) upon request after the publication of this manuscript. The data include experiment records, raw data, and analysis. The authors confirm that all data underlying the findings will be made fully available without restriction upon publication.

## Code availability

The code used to analyze Sholl data is available on the link [https://github.com/Eroglu-Lab/Sholl\_Macro](https://github.com/Eroglu-Lab/Sholl_Macro).

## FIGURE LEGENDS

![Extended Data Figure 1 (related to Figure 1).](http://biorxiv.org/https://www.biorxiv.org/content/biorxiv/early/2023/04/10/2023.04.09.536178/F5.medium.gif)

[Extended Data Figure 1 (related to Figure 1).](http://biorxiv.org/content/early/2023/04/10/2023.04.09.536178/F5)

Extended Data Figure 1 (related to Figure 1). Localization and expression of LRRK2 in astrocytes
**a-b,** LRRK2 (red) in the primary motor cortex (MOp) of LRRK2 G2019Ski/ki; Aldh1l1-eGFP mice at P21. Scale bar, 10 µm. **c,** Cultured WT and LRRK2 KO rat cortical astrocytes were lysed, and cytoplasmic proteins were subjected to Western blotting, using LRRK2 and β-actin antibodies. Results are representative of 4 independent experiments. **d,** Densitometric analysis of LRRK2 levels in **Extended Data Fig. 1c**. Signals corresponding to LRRK2 were normalized to that for β-actin. Relative LRRK2 levels were then normalized to the LRRK2 signals in WT rat cortical astrocytes. Statistical significance was determined by an Unpaired Two-tailed t-test [t (6) = 13.79], *p* < 0.0001. **e,** Cultured WT and LRRK2 G2019S rat cortical astrocytes were lysed, and cytoplasmic proteins were subjected to Western blotting using LRRK2 and β-actin antibodies. Results are representative of 3 independent experiments. **f,** Densitometric analysis of LRRK2 levels in **Extended Data Fig. 1e**. Signals corresponding to LRRK2 were normalized to that for β-actin. Relative LRRK2 levels were then normalized to the LRRK2 signals in WT rat cortical astrocytes. Statistical significance was determined by an Unpaired Two-tailed t-test [t (4) = 47.96], *p* < 0.0001. **g,** Cultured WT, and shControl and sh*Lrrk2* transfected rat cortical astrocytes were lysed, and cytoplasmic proteins were subjected to Western blotting using LRRK2 and GAPDH antibodies. Results are representative of 3 independent experiments. **h,** Densitometric analysis of LRRK2 levels in **Extended Data Fig. 1g**. Signals corresponding to LRRK2 were first normalized to that for β-actin. Relative LRRK2 levels were then normalized to the LRRK2 signals in WT rat cortical astrocytes. Statistical significance was determined by One-way ANOVA [F (2, 6) = 92.25, *p* < 0.0001], Bonferroni multiple comparison revealed a significant difference between WT and sh*Lrrk2* (*p* < 0.0001, 95% C.I. = [0.6743, 1.183]) and between sh*Lrrk2* and shControl (*p* < 0.0001, 95% C.I. = [-1.145, -0.6363]) and no differences between WT and shControl (*p* > 0.9999, 95% C.I. = [-0.2165, 0.2923]), alpha = 0.05. **i-j,** Bar plots of Ezr, Rdx, and Msn gene expression in various brain cell types in mice (yellow) or humans (red). These plots are generated using publicly available data at [https://www.brainrnaseq.org/52,172](https://www.brainrnaseq.org/52,172).

![Extended Data Figure 2 (related to Figure 2).](http://biorxiv.org/https://www.biorxiv.org/content/biorxiv/early/2023/04/10/2023.04.09.536178/F6.medium.gif)

[Extended Data Figure 2 (related to Figure 2).](http://biorxiv.org/content/early/2023/04/10/2023.04.09.536178/F6)

Extended Data Figure 2 (related to Figure 2). Phospho-ERM is upregulated in LRRK2 G2019Ski/ki astrocytes in ACC and MOp but not SSp and DMS
**a-b,** Representative confocal images of ERM phosphorylation (purple) in the MOp and ACC of WT or LRRK2 G2019Ski/ki Aldh1l1-eGFP transgenic mice at P84. Scale bar, 200 μm. N = 4 (WT, 2 males and 2 females), 4 (LRRK2 G2019Ski/ki, 2 males and 2 females) mice. c, Quantification of phospho-ERM integrated density in a-b, n = 4 (WT, 2 males and 2 females), 4 (LRRK2 G2019Ski/ki, 2 males and 2 females) mice, For phospho-ERM quantification in the ACC, nested t-test, unpaired Two-tailed t-test. t (14) = 11.84, *p* < 0.0001. For phospho-ERM quantification in the MOp, nested t-test, unpaired Two-tailed t-test. t (14) = 6.585, *p* < 0.0001. Grey dots are the data acquired from each image. Black dots are the averaged data acquired from each WT mouse. Blue dots are the averaged data acquired from each LRRK2 G2019Ski/ki mouse. d-e, Representative confocal images of ERM phosphorylation (purple) in the MOp and ACC of WT or LRRK2 G2019Ski/ki Aldh1l1-eGFP transgenic mice at P84. Scale bar, 20 μm. f-g, Representative confocal images of ERM phosphorylation (purple) in the SSp and DMS of WT or LRRK2 G2019Ski/ki Aldh1l1-eGFP transgenic mice at P21. Scale bar, 200 μm. n = 4 (WT, 2 males and 2 females), 4 (LRRK2 G2019Ski/ki, 2 males and 2 females) mice. h, Quantification of phospho-ERM integrated density in f-g and i-j, n = 4 (WT, 2 males and 2 females), 4 (LRRK2 G2019Ski/ki, 2 males and 2 females) mice. For phospho-ERM integrated density at P21, nested t-test, unpaired Two-tailed t-test. t (22) = 0.1556, *p* = 0.8777. For phospho-ERM integrated density at 12-week-old, nested t-test, unpaired Two-tailed t-test. t (4) = 0.5028, *p* = 0.6415. Grey dots are the data acquired from each image. Black dots are the averaged data acquired from each WT mouse. Blue dots are the averaged data acquired from each LRRK2 G2019Ski/ki mouse. i-j, Representative confocal images of ERM phosphorylation (purple) in the SSp and DMS of WT or LRRK2 G2019Ski/ki Aldh11-eGFP transgenic mice at P84. Scale bar, 200 μm. n = 4 (WT, 2 males and 2 females), 4 (LRRK2 G2019Ski/ki, 2 males and 2 females) mice. k, Overview of postnatal astrocyte labeling by electroporation (PALE) with PiggyBac plasmids.

![Extended Data Figure 3 (related to Figure 2).](http://biorxiv.org/https://www.biorxiv.org/content/biorxiv/early/2023/04/10/2023.04.09.536178/F7.medium.gif)

[Extended Data Figure 3 (related to Figure 2).](http://biorxiv.org/content/early/2023/04/10/2023.04.09.536178/F7)

Extended Data Figure 3 (related to Figure 2). LRRK2 G2019S does not change GFAP level and ALDH1L1+/SOX9+ cell numbers in the ACC and MOp
**a-b,** Representative confocal images of SOX9 (purple) in the ACC and MOp of WT or LRRK2 G2019Ski/ki Aldh1l1-eGFP transgenic mice at P21. Scale bar, 200 μm. c, Quantification of ALDH1L1+/SOX9+ cell numbers in a-b, n = 3 (WT, 2 males and 1 female), 3 (LRRK2 G2019Ski/ki, 2 males and 1 female) mice, For ALDH1L1+/SOX9+ cell counting in the ACC, nested t-test, unpaired Two-tailed t-test. t (9) = 1.533, *p* = 0.2470. For ALDH1L1+/SOX9+ cell counting in the MOp, nested t-test, unpaired Two-tailed t-test. t (2) = 1.544, *p* = 0.2625. Grey dots are the data acquired from each image. Black dots are the averaged data acquired from each WT mouse. Blue dots are the averaged data acquired from each LRRK2 G2019Ski/ki mouse. d-e, Representative confocal images of GFAP (purple) in the ACC and MOp of WT or LRRK2 G2019Ski/ki Aldh1l1-eGFP transgenic mice at P21. Scale bar, 200 μm. f, Quantification of GFAP integrated density in d-e, n = 3 (WT, 2 males and 1 female), 3 (LRRK2 G2019Ski/ki, 2 males and 1 female) mice, For GFAP quantification in the ACC, nested t-test, unpaired Two-tailed t-test. t (10) = 1.524, *p* = 0.1586. For GFAP quantification in the MOp, nested t-test, unpaired Two-tailed t-test. t (10) = 0.5028, *p* = 0.6260. Grey dots are the data acquired from each image. Black dots are the averaged data acquired from each WT mouse. Blue dots are the averaged data acquired from each LRRK2 G2019Ski/ki mouse.

![Extended Data Figure 4 (related to Figure 3).](http://biorxiv.org/https://www.biorxiv.org/content/biorxiv/early/2023/04/10/2023.04.09.536178/F8.medium.gif)

[Extended Data Figure 4 (related to Figure 3).](http://biorxiv.org/content/early/2023/04/10/2023.04.09.536178/F8)

Extended Data Figure 4 (related to Figure 3). LRRK2 G2019S does not change excitatory synapse numbers in the primary motor cortex
**a,** (Left) Representative images from the ventral ACC layer 1 of WT and LRRK2 G2019Ski/ki mice that were stained with VGAT and GEPHYRIN antibodies at 12-week-old. Scale bar, 10 μm. (Right) Quantification of VGAT/GEPHYRIN co-localized puncta, normalized using the means of WT values in the ventral ACC layer 1. n = 4 (WT, 2 males and 2 females), 4 (LRRK2 G2019Ski/ki, 2 males and 2 females) mice, nested t-test, unpaired Two-tailed t-test. t (22) = 0.3365, *p* = 0.7397. Grey dots are the data acquired from each synapse image. Black dots are the averaged data acquired from each WT mouse. Blue dots are the averaged data acquired from each LRRK2 G2019Ski/ki mouse. b, (Left) Representative images from the ventral ACC layer 2/3 of WT and LRRK2 G2019Ski/ki mice that were stained with VGAT and GEPHYRIN antibodies at 12-week-old. Scale bar, 10 μm. (Right) Quantification of VGAT/GEPHYRIN co-localized puncta, normalized using the means of WT values in the ventral ACC layer 2/3. n = 4 (WT, 2 males and 2 females), 4 (LRRK2 G2019Ski/ki, 2 males and 2 females) mice, nested t-test, unpaired Two-tailed t-test. t (21) = 0.4692, *p* = 0.6438. c, (Left) Representative images from the MOp layer 1 of WT and LRRK2 G2019Ski/ki mice that were stained with VGluT1 and PSD95 antibodies at 12-week-old. Scale bar, 10 μm. (Right) Quantification of VGluT1/PSD95 co-localized puncta in c, normalized using the means of WT values in the MOp layer 1. n = 5 (WT), 5 (LRRK2 G2019Ski/ki) mice, 3 males and 2 females, nested t-test, unpaired Two-tailed t-test. t (28) = 1.012, *p* = 0.3203. d, (Left) Representative images from the MOp layer 2/3 of WT and LRRK2 G2019Ski/ki mice that were stained with VGluT1 and PSD95 antibodies at 12-week-old. Scale bar, 10 μm. (Right) Quantification of VGluT1/PSD95 co-localized puncta in c, normalized using the means of WT values in the MOp layer 2/3. n = 5 (WT), 5 (LRRK2 G2019Ski/ki) mice, 3 males and 2 females, nested t-test, unpaired Two-tailed t-test. t (4) = 0.20465, *p* = 0.8479.

![Extended Data Figure 4 (related to Figure 5).](http://biorxiv.org/https://www.biorxiv.org/content/biorxiv/early/2023/04/10/2023.04.09.536178/F9.medium.gif)

[Extended Data Figure 4 (related to Figure 5).](http://biorxiv.org/content/early/2023/04/10/2023.04.09.536178/F9)

Extended Data Figure 4 (related to Figure 5). Overexpression of AAV-HA-tagged-WT EZRIN and AAV-HA-tagged-Phospho-dead EZRIN in WT and LRRK2 G2019Ski/ki astrocytes
**a,** Experiment workflow of AAV-HA-tagged-WT EZRIN and AAV-HA-tagged-Phospho-dead EZRIN in WT and LRRK2 G2019Ski/ki astrocytes. b, Representative images from the ventral ACC of WT and LRRK2 G2019Ski/ki mice injected with AAV-HA-tagged-WT EZRIN or AAV-HA-tagged-Phospho-dead EZRIN that were stained with HA and phospho-ERM antibodies at 12-week-old. Scale bar, 200 μm. n = 6 (WT + WT EZRIN O/E, 3 males and 3 females), 5 (WT + Phospho-dead EZRIN O/E, 3 males and 2 females), 6 (LRRK2 G2019Ski/ki + WT EZRIN O/E, 3 males and 3 females), 6 (LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E, 3 males and 3 females) mice. c, Representative images from the MOp layer 1 of WT and LRRK2 G2019Ski/ki mice injected with AAV-HA-tagged-WT EZRIN or AAV-HA-tagged-Phospho-dead EZRIN that were stained with VGAT and GEPHYRIN antibodies at 12-week-old. Scale bar, 10 μm. Quantification of VGAT/ GEPHYRIN co-localized puncta, normalized using the means of WT mice injected with AAV-HA-tagged-WT EZRIN in MOp layer 1. n = 3 (WT + WT EZRIN O/E, 2 males and 1 female), 5 (WT + Phospho-dead EZRIN O/E, 3 males and 2 females), 6 (LRRK2 G2019Ski/ki + WT EZRIN O/E, 3 males and 3 females), 6 (LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E, 3 males and 3 females) mice. One-way ANOVA [F (3, 55) = 19.7, *p* < 0.0001], Bonferroni’s multiple comparisons test revealed a significant difference between WT + WT EZRIN O/E and LRRK2 G2019Ski/ki + WT EZRIN O/E (*p* < 0.0001, 95% C.I. = [-98.23, -32.48]), and between WT + Phospho-dead EZRIN O/E and LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E (*p* < 0.0001, 95% C.I. = [-82.37, -26.61]). There were no differences between WT + WT EZRIN O/E and WT + Phospho-dead EZRIN O/E (*p* = 0.6323, 95% C.I. = [-53.85, 13.40]), and between LRRK2 G2019Ski/ki + WT EZRIN O/E and LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E (*p* > 0.9999, 95% C.I. = [-36.33, 17.61]), alpha = 0.05. d, Representative images from the MOp layer 2/3 of WT and LRRK2 G2019Ski/ki mice injected with AAV-HA-tagged-WT EZRIN or AAV-HA-tagged-Phospho-dead EZRIN that were stained with VGAT1 and GEPHYRIN antibodies at 12-week-old. Scale bar, 10 μm. Quantification of VGAT/GEPHYRIN co-localized puncta, normalized using the means of WT mice injected with AAV-HA-tagged-WT EZRIN in MOp layer 2/3. n = 3 (WT + WT EZRIN O/E, 2 males and 1 female), 5 (WT + Phospho-dead EZRIN O/E, 3 males and 2 females), 6 (LRRK2 G2019Ski/ki + WT EZRIN O/E, 3 males and 3 females), 6 (LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E, 3 males and 3 females) mice. One-way ANOVA [F (3, 54) = 15.10, *p* < 0.0001], Bonferroni’s multiple comparisons test revealed a significant difference between WT + WT EZRIN O/E and LRRK2 G2019Ski/ki + WT EZRIN O/E (*p* = 0.0107, 95% C.I. = [-65.46, -5.94]), and between WT + Phospho-dead EZRIN O/E and LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E (*p* < 0.0001, 95% C.I. = [-78.07, -26.92]). There were no differences between WT + WT EZRIN O/E and WT + Phospho-dead EZRIN O/E (*p* > 0.9999, 95% C.I. = [-37.73, 23.15]), and between LRRK2 G2019Ski/ki + WT EZRIN O/E and LRRK2 G2019Ski/ki + Phospho-dead EZRIN O/E (*p* = 0.0610, 95% C.I. = [-48.84, 0.6819]), alpha = 0.05.

## Acknowledgments:

We thank Drs. Nicole Calakos, Katja Brose, Andrew Singleton, Dolores Irala, Francesco P. Ulloa Severino, Juan Ramirez, Justin T. Savage, Gabrielle Séjourné, and other Eroglu lab members for critical feedback about the manuscript. We thank Adam Okinaga and Donna Porter for excellent technical help. This work was supported by a Foerster Bernstein Women In STEM Postdoctoral Fellowship to SW, and a Chan Zuckerberg Initiative, Neurodegeneration Challenge Network Collaborative grant (2018-191999 and DAF2021-237435) to CE and ARLS, and by the N.I.H. grants R35-NS122140 to A.R.L.S. and R01-NS102237 to CE, and by the Michael J. Fox Foundation for Parkinson’s Research (MJFF) Astrocyte Biology in PD pilot grant (MJFF 17914 to CE and ARLS), and by the joint efforts of MJFF and the Aligning Science Across Parkinson’s (ASAP) initiative. MJFF administers the grant [ASAP-020607 to CE and SHS] on behalf of ASAP and itself Michael J Fox Foundation. Dr. Cagla Eroglu is an HHMI Investigator. We are grateful to the Banner Sun Health Research Institute Brain and Body Donation Program of Sun City, Arizona for the provision of human biological materials. The Brain and Body Donation Program has been supported by the National Institute of Neurological Disorders and Stroke (U24 NS072026 National Brain and Tissue Resource for Parkinson’s Disease and Related Disorders), the National Institute on Aging (P30AG19610 and P30AG072980, Arizona Alzheimer’s Disease Center), the Arizona Biomedical Research Commission contracts 4001, 0011, 05-901 and 1001 to the Arizona Parkinson’s Disease Consortium) and the Michael J. Fox Foundation for Parkinson’s Research.

*   Received April 9, 2023.
*   Revision received April 9, 2023.
*   Accepted April 9, 2023.


*   © 2023, Posted by Cold Spring Harbor Laboratory

The copyright holder for this pre-print is the author. All rights reserved. The material may not be redistributed, re-used or adapted without the author's permission.

## REFERENCE

1.  Khakh, B. S. & Sofroniew, M. V. Diversity of astrocyte functions and phenotypes in neural circuits. Nat Neurosci 18, 942–952, doi:10.1038/nn.4043 (2015).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/nn.4043&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=26108722&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

2.  Torres-Ceja, B. & Olsen, M. L. A closer look at astrocyte morphology: Development, heterogeneity, and plasticity at astrocyte leaflets. Curr Opin Neurobiol 74, 102550, doi:10.1016/j.conb.2022.102550 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.conb.2022.102550&link_type=DOI) 

3.  Allen, N. J. & Lyons, D. A. Glia as architects of central nervous system formation and function. Science 362, 181–185, doi:10.1126/science.aat0473 (2018).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6Mzoic2NpIjtzOjU6InJlc2lkIjtzOjEyOiIzNjIvNjQxMS8xODEiO3M6NDoiYXRvbSI7czo0ODoiL2Jpb3J4aXYvZWFybHkvMjAyMy8wNC8xMC8yMDIzLjA0LjA5LjUzNjE3OC5hdG9tIjt9czo4OiJmcmFnbWVudCI7czowOiIiO30=) 

4.  Eroglu, C. & Barres, B. A. Regulation of synaptic connectivity by glia. Nature 468, 223–231, doi:10.1038/nature09612 (2010).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/nature09612&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=21068831&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000284051000039&link_type=ISI) 

5.  Hirrlinger, J. & Nimmerjahn, A. A perspective on astrocyte regulation of neural circuit function and animal behavior. Glia 70, 1554–1580, doi:10.1002/glia.24168 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1002/glia.24168&link_type=DOI) 

6.  Sofroniew, M. V. Astrocyte Reactivity: Subtypes, States, and Functions in CNS Innate Immunity. Trends Immunol 41, 758–770, doi:10.1016/j.it.2020.07.004 (2020).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.it.2020.07.004&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=32819810&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

7.  di Domenico, A. et al. Patient-Specific iPSC-Derived Astrocytes Contribute to Non-Cell-Autonomous Neurodegeneration in Parkinson’s Disease. Stem Cell Reports 12, 213–229, doi:10.1016/j.stemcr.2018.12.011 (2019).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.stemcr.2018.12.011&link_type=DOI) 

8.  Liddelow, S. A. et al. Neurotoxic reactive astrocytes are induced by activated microglia. Nature 541, 481–487, doi:10.1038/nature21029 (2017).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/nature21029&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=28099414&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

9.  Saijo, K. et al. A Nurr1/CoREST pathway in microglia and astrocytes protects dopaminergic neurons from inflammation-induced death. Cell 137, 47–59, doi:10.1016/j.cell.2009.01.038 (2009).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.cell.2009.01.038&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=19345186&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000264813300013&link_type=ISI) 

10. Chan, C. S., Gertler, T. S. & Surmeier, D. J. Calcium homeostasis, selective vulnerability and Parkinson’s disease. Trends Neurosci 32, 249–256, doi:10.1016/j.tins.2009.01.006 (2009).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.tins.2009.01.006&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=19307031&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000266524400002&link_type=ISI) 

11. Kam, T. I., Hinkle, J. T., Dawson, T. M. & Dawson, V. L. Microglia and astrocyte dysfunction in parkinson’s disease. Neurobiol Dis 144, 105028, doi:10.1016/j.nbd.2020.105028 (2020).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.nbd.2020.105028&link_type=DOI) 

12. Brandebura, A. N., Paumier, A., Onur, T. S. & Allen, N. J. Astrocyte contribution to dysfunction, risk and progression in neurodegenerative disorders. Nat Rev Neurosci, doi:10.1038/s41583-022-00641-1 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/s41583-022-00641-1&link_type=DOI) 

13. Guttenplan, K. A. et al. Neurotoxic reactive astrocytes induce cell death via saturated lipids. Nature 599, 102–107, doi:10.1038/s41586-021-03960-y (2021).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/s41586-021-03960-y&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=34616039&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

14. Yun, S. P. et al. Block of A1 astrocyte conversion by microglia is neuroprotective in models of Parkinson’s disease. Nat Med 24, 931–938, doi:10.1038/s41591-018-0051-5 (2018).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/s41591-018-0051-5&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=29892066&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

15. Nagai, J. et al. Behaviorally consequential astrocytic regulation of neural circuits. Neuron 109, 576–596, doi:10.1016/j.neuron.2020.12.008 (2021).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.neuron.2020.12.008&link_type=DOI) 

16. Lavialle, M. et al. Structural plasticity of perisynaptic astrocyte processes involves ezrin and metabotropic glutamate receptors. Proc Natl Acad Sci U S A 108, 12915–12919, doi:10.1073/pnas.1100957108 (2011).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6NDoicG5hcyI7czo1OiJyZXNpZCI7czoxMjoiMTA4LzMxLzEyOTE1IjtzOjQ6ImF0b20iO3M6NDg6Ii9iaW9yeGl2L2Vhcmx5LzIwMjMvMDQvMTAvMjAyMy4wNC4wOS41MzYxNzguYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9) 

17. Derouiche, A., Anlauf, E., Aumann, G., Muhlstadt, B. & Lavialle, M. Anatomical aspects of glia-synapse interaction: the perisynaptic glial sheath consists of a specialized astrocyte compartment. J Physiol Paris 96, 177–182, doi:10.1016/s0928-4257(02)00004-9 (2002).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/S0928-4257(02)00004-9&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=12445894&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000180491700003&link_type=ISI) 

18. Semyanov, A. & Verkhratsky, A. Astrocytic processes: from tripartite synapses to the active milieu. Trends Neurosci 44, 781–792, doi:10.1016/j.tins.2021.07.006 (2021).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.tins.2021.07.006&link_type=DOI) 

19. Farizatto, K. L. G. & Baldwin, K. T. Astrocyte-synapse interactions during brain development. Curr Opin Neurobiol 80, 102704, doi:10.1016/j.conb.2023.102704 (2023).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.conb.2023.102704&link_type=DOI) 

20. Hasan, U. & Singh, S. K. The Astrocyte-Neuron Interface: An Overview on Molecular and Cellular Dynamics Controlling Formation and Maintenance of the Tripartite Synapse. Methods Mol Biol 1938, 3–18, doi:10.1007/978-1-4939-9068-9_1 (2019).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1007/978-1-4939-9068-9_1&link_type=DOI) 

21. Lyon, K. A. & Allen, N. J. From Synapses to Circuits, Astrocytes Regulate Behavior. Front Neural Circuits 15, 786293, doi:10.3389/fncir.2021.786293 (2021).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.3389/fncir.2021.786293&link_type=DOI) 

22. Allen, N. J. & Barres, B. A. Neuroscience: Glia - more than just brain glue. Nature 457, 675–677, doi:10.1038/457675a (2009).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/457675a&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=19194443&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000263064700031&link_type=ISI) 

23. Murphy-Royal, C., Dupuis, J., Groc, L. & Oliet, S. H. R. Astroglial glutamate transporters in the brain: Regulating neurotransmitter homeostasis and synaptic transmission. J Neurosci Res 95, 2140–2151, doi:10.1002/jnr.24029 (2017).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1002/jnr.24029&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=28150867&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

24. Farhy-Tselnicker, I. & Allen, N. J. Astrocytes, neurons, synapses: a tripartite view on cortical circuit development. Neural Dev 13, 7, doi:10.1186/s13064-018-0104-y (2018).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1186/s13064-018-0104-y&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=29712572&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

25. Allen, N. J. & Eroglu, C. Cell Biology of Astrocyte-Synapse Interactions. Neuron 96, 697–708, doi:10.1016/j.neuron.2017.09.056 (2017).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.neuron.2017.09.056&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=29096081&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

26. Clavreul, S. et al. Cortical astrocytes develop in a plastic manner at both clonal and cellular levels. Nat Commun 10, 4884, doi:10.1038/s41467-019-12791-5 (2019).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/s41467-019-12791-5&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=31653848&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

27. Takano, T. et al. Chemico-genetic discovery of astrocytic control of inhibition in vivo. Nature 588, 296–302, doi:10.1038/s41586-020-2926-0 (2020).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/s41586-020-2926-0&link_type=DOI) 

28. Stogsdill, J. A. et al. Astrocytic neuroligins control astrocyte morphogenesis and synaptogenesis. Nature 551, 192–197, doi:10.1038/nature24638 (2017).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/nature24638&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=29120426&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

29. Porter, J. T. & McCarthy, K. D. Astrocytic neurotransmitter receptors in situ and in vivo. Prog Neurobiol 51, 439–455, doi:10.1016/s0301-0082(96)00068-8 (1997).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/S0301-0082(96)00068-8&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=9106901&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=A1997WR51000004&link_type=ISI) 

30. Kofuji, P. & Araque, A. G-Protein-Coupled Receptors in Astrocyte-Neuron Communication. Neuroscience 456, 71–84, doi:10.1016/j.neuroscience.2020.03.025 (2021).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.neuroscience.2020.03.025&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=32224231&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

31. Tan, C. X. & Eroglu, C. Cell adhesion molecules regulating astrocyte-neuron interactions. Curr Opin Neurobiol 69, 170–177, doi:10.1016/j.conb.2021.03.015 (2021).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.conb.2021.03.015&link_type=DOI) 

32. Holt, L. M. et al. Astrocyte morphogenesis is dependent on BDNF signaling via astrocytic TrkB.T1. Elife 8, doi:10.7554/eLife.44667 (2019).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.7554/eLife.44667&link_type=DOI) 

33. Braak, H., Sastre, M. & Del Tredici, K. Development of alpha-synuclein immunoreactive astrocytes in the forebrain parallels stages of intraneuronal pathology in sporadic Parkinson’s disease. Acta Neuropathol 114, 231–241, doi:10.1007/s00401-007-0244-3 (2007).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1007/s00401-007-0244-3&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=17576580&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

34. Wakabayashi, K., Hayashi, S., Yoshimoto, M., Kudo, H. & Takahashi, H. NACP/alpha-synuclein-positive filamentous inclusions in astrocytes and oligodendrocytes of Parkinson’s disease brains. Acta Neuropathol 99, 14–20, doi:10.1007/pl00007400 (2000).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1007/PL00007400&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=10651022&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

35. Tolosa, E., Garrido, A., Scholz, S. W. & Poewe, W. Challenges in the diagnosis of Parkinson’s disease. Lancet Neurol 20, 385–397, doi:10.1016/S1474-4422(21)00030-2 (2021).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/S1474-4422(21)00030-2&link_type=DOI) 

36. Bloem, B. R., Okun, M. S. & Klein, C. Parkinson’s disease. Lancet 397, 2284–2303, doi:10.1016/S0140-6736(21)00218-X (2021).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/S0140-6736(21)00218-X&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=33848468&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

37. Kalia, L. V. & Lang, A. E. Parkinson’s disease. Lancet 386, 896–912, doi:10.1016/S0140-6736(14)61393-3 (2015).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/S0140-6736(14)61393-3&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=25904081&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

38. Maiti, P., Manna, J. & Dunbar, G. L. Current understanding of the molecular mechanisms in Parkinson’s disease: Targets for potential treatments. Transl Neurodegener 6, 28, doi:10.1186/s40035-017-0099-z (2017).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1186/s40035-017-0099-z&link_type=DOI) 

39. Dauer, W. & Przedborski, S. Parkinson’s disease: mechanisms and models. Neuron 39, 889–909, doi:10.1016/s0896-6273(03)00568-3 (2003).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/s0896-6273(03)00568-3&link_type=DOI) 

40. Hussein, A. et al. Non-Motor Symptoms of Parkinson’s Disease: The Neurobiology of Early Psychiatric and Cognitive Dysfunction. Neuroscientist, 10738584211011979, doi:10.1177/10738584211011979 (2021).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1177/10738584211011979&link_type=DOI) 

41. Pachi, I. et al. Apathy: An underestimated feature in GBA and LRRK2 non-manifesting mutation carriers. Parkinsonism Relat Disord 91, 1–8, doi:10.1016/j.parkreldis.2021.08.008 (2021).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.parkreldis.2021.08.008&link_type=DOI) 

42. Weintraub, D. et al. The neuropsychiatry of Parkinson’s disease: advances and challenges. Lancet Neurol 21, 89–102, doi:10.1016/S1474-4422(21)00330-6 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/S1474-4422(21)00330-6&link_type=DOI) 

43. Belarbi, S. et al. LRRK2 G2019S mutation in Parkinson’s disease: a neuropsychological and neuropsychiatric study in a large Algerian cohort. Parkinsonism Relat Disord 16, 676–679, doi:10.1016/j.parkreldis.2010.09.003 (2010).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.parkreldis.2010.09.003&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=20933457&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

44. Blesa, J., Foffani, G., Dehay, B., Bezard, E. & Obeso, J. A. Motor and non-motor circuit disturbances in early Parkinson disease: which happens first? Nat Rev Neurosci 23, 115–128, doi:10.1038/s41583-021-00542-9 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/s41583-021-00542-9&link_type=DOI) 

45. Foffani, G. & Obeso, J. A. A Cortical Pathogenic Theory of Parkinson’s Disease. Neuron 99, 1116–1128, doi:10.1016/j.neuron.2018.07.028 (2018).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.neuron.2018.07.028&link_type=DOI) 

46. Dong, X. X., Wang, Y. & Qin, Z. H. Molecular mechanisms of excitotoxicity and their relevance to pathogenesis of neurodegenerative diseases. Acta Pharmacol Sin 30, 379–387, doi:10.1038/aps.2009.24 (2009).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/aps.2009.24&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=19343058&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000265151100001&link_type=ISI) 

47. Booth, H. D. E., Hirst, W. D. & Wade-Martins, R. The Role of Astrocyte Dysfunction in Parkinson’s Disease Pathogenesis. Trends Neurosci 40, 358–370, doi:10.1016/j.tins.2017.04.001 (2017).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.tins.2017.04.001&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=28527591&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

48. Bandres-Ciga, S., Diez-Fairen, M., Kim, J. J. & Singleton, A. B. Genetics of Parkinson’s disease: An introspection of its journey towards precision medicine. Neurobiol Dis 137, 104782, doi:10.1016/j.nbd.2020.104782 (2020).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.nbd.2020.104782&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=http://www.n&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

49. Pang, S. Y. et al. LRRK2, GBA and their interaction in the regulation of autophagy: implications on therapeutics in Parkinson’s disease. Transl Neurodegener 11, 5, doi:10.1186/s40035-022-00281-6 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1186/s40035-022-00281-6&link_type=DOI) 

50. Udayar, V., Chen, Y., Sidransky, E. & Jagasia, R. Lysosomal dysfunction in neurodegeneration: emerging concepts and methods. Trends Neurosci 45, 184–199, doi:10.1016/j.tins.2021.12.004 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.tins.2021.12.004&link_type=DOI) 

51. Najafi, S. et al. Recent insights into the roles of circular RNAs in human brain development and neurologic diseases. Int J Biol Macromol, doi:10.1016/j.ijbiomac.2022.11.166 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.ijbiomac.2022.11.166&link_type=DOI) 

52. Zhang, Y. et al. Purification and Characterization of Progenitor and Mature Human Astrocytes Reveals Transcriptional and Functional Differences with Mouse. Neuron 89, 37–53, doi:10.1016/j.neuron.2015.11.013 (2016).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.neuron.2015.11.013&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=26687838&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

53. Uhlen, M. et al. Proteomics. Tissue-based map of the human proteome. Science 347, 1260419, doi:10.1126/science.1260419 (2015).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6Mzoic2NpIjtzOjU6InJlc2lkIjtzOjE2OiIzNDcvNjIyMC8xMjYwNDE5IjtzOjQ6ImF0b20iO3M6NDg6Ii9iaW9yeGl2L2Vhcmx5LzIwMjMvMDQvMTAvMjAyMy4wNC4wOS41MzYxNzguYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9) 

54. Digre, A. & Lindskog, C. The Human Protein Atlas-Spatial localization of the human proteome in health and disease. Protein Sci 30, 218–233, doi:10.1002/pro.3987 (2021).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1002/pro.3987&link_type=DOI) 

55. Gilks, W. P. et al. A common LRRK2 mutation in idiopathic Parkinson’s disease. Lancet 365, 415–416, doi:10.1016/S0140-6736(05)17830-1 (2005).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/S0140-6736(05)17830-1&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=15680457&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000226610900029&link_type=ISI) 

56. Benamer, H. T. The ancestry of LRRK2 Gly2019Ser parkinsonism. Lancet Neurol 7, 769–770; author reply 770-761, doi:10.1016/S1474-4422(08)70178-9 (2008).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/S1474-4422(08)70178-9&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=18702998&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

57. Ren, C. et al. G2019S Variation in LRRK2: An Ideal Model for the Study of Parkinson’s Disease? Front Hum Neurosci 13, 306, doi:10.3389/fnhum.2019.00306 (2019).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.3389/fnhum.2019.00306&link_type=DOI) 

58. West, A. B. et al. Parkinson’s disease-associated mutations in leucine-rich repeat kinase 2 augment kinase activity. Proc Natl Acad Sci U S A 102, 16842–16847, doi:10.1073/pnas.0507360102 (2005).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6NDoicG5hcyI7czo1OiJyZXNpZCI7czoxMjoiMTAyLzQ2LzE2ODQyIjtzOjQ6ImF0b20iO3M6NDg6Ii9iaW9yeGl2L2Vhcmx5LzIwMjMvMDQvMTAvMjAyMy4wNC4wOS41MzYxNzguYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9) 

59. Greggio, E. et al. Kinase activity is required for the toxic effects of mutant LRRK2/dardarin. Neurobiol Dis 23, 329–341, doi:10.1016/j.nbd.2006.04.001 (2006).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.nbd.2006.04.001&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=16750377&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000239611700009&link_type=ISI) 

60. Jaleel, M. et al. LRRK2 phosphorylates moesin at threonine-558: characterization of how Parkinson’s disease mutants affect kinase activity. Biochem J 405, 307–317, doi:10.1042/BJ20070209 (2007).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6MTA6InBwYmlvY2hlbWoiO3M6NToicmVzaWQiO3M6OToiNDA1LzIvMzA3IjtzOjQ6ImF0b20iO3M6NDg6Ii9iaW9yeGl2L2Vhcmx5LzIwMjMvMDQvMTAvMjAyMy4wNC4wOS41MzYxNzguYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9) 

61. Ito, G. et al. Phos-tag analysis of Rab10 phosphorylation by LRRK2: a powerful assay for assessing kinase function and inhibitors. Biochem J 473, 2671–2685, doi:10.1042/BCJ20160557 (2016).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6MTA6InBwYmlvY2hlbWoiO3M6NToicmVzaWQiO3M6MTE6IjQ3My8xNy8yNjcxIjtzOjQ6ImF0b20iO3M6NDg6Ii9iaW9yeGl2L2Vhcmx5LzIwMjMvMDQvMTAvMjAyMy4wNC4wOS41MzYxNzguYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9) 

62. Steger, M. et al. Systematic proteomic analysis of LRRK2-mediated Rab GTPase phosphorylation establishes a connection to ciliogenesis. Elife 6, doi:10.7554/eLife.31012 (2017).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.7554/eLife.31012&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=29125462&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

63. Steger, M. et al. Phosphoproteomics reveals that Parkinson’s disease kinase LRRK2 regulates a subset of Rab GTPases. Elife 5, doi:10.7554/eLife.12813 (2016).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.7554/eLife.12813&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=26824392&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

64. Kluss, J. H., Mamais, A. & Cookson, M. R. LRRK2 links genetic and sporadic Parkinson’s disease. Biochem Soc Trans 47, 651–661, doi:10.1042/BST20180462 (2019).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6NzoicHBiaW9zdCI7czo1OiJyZXNpZCI7czo4OiI0Ny8yLzY1MSI7czo0OiJhdG9tIjtzOjQ4OiIvYmlvcnhpdi9lYXJseS8yMDIzLzA0LzEwLzIwMjMuMDQuMDkuNTM2MTc4LmF0b20iO31zOjg6ImZyYWdtZW50IjtzOjA6IiI7fQ==) 

65. Monfrini, E. & Di Fonzo, A. Leucine-Rich Repeat Kinase (LRRK2) Genetics and Parkinson’s Disease. Adv Neurobiol 14, 3–30, doi:10.1007/978-3-319-49969-7_1 (2017).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1007/978-3-319-49969-7_1&link_type=DOI) 

66. Mestre, T. A. et al. Clustering of motor and nonmotor traits in leucine-rich repeat kinase 2 G2019S Parkinson’s disease nonparkinsonian relatives: A multicenter family study. Mov Disord 33, 960–965, doi:10.1002/mds.27272 (2018).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1002/mds.27272&link_type=DOI) 

67. Chang, E. E. S. et al. LRRK2 mutant knock-in mouse models: therapeutic relevance in Parkinson’s disease. Translational Neurodegeneration 11, doi:ARTN 10 doi:10.1186/s40035-022-00285-2 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1186/s40035-022-00285-2&link_type=DOI) 

68. Yue, M. et al. Progressive dopaminergic alterations and mitochondrial abnormalities in LRRK2 G2019S knock-in mice. Neurobiol Dis 78, 172–195, doi:10.1016/j.nbd.2015.02.031 (2015).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.nbd.2015.02.031&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=25836420&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

69. Longo, F. et al. Age-dependent dopamine transporter dysfunction and Serine129 phospho-alpha-synuclein overload in G2019S LRRK2 mice. Acta Neuropathol Commun 5, 22, doi:10.1186/s40478-017-0426-8 (2017).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1186/s40478-017-0426-8&link_type=DOI) 

70. Narayanan, N. S., Rodnitzky, R. L. & Uc, E. Y. Prefrontal dopamine signaling and cognitive symptoms of Parkinson’s disease. Rev Neurosci 24, 267–278, doi:10.1515/revneuro-2013-0004 (2013).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1515/revneuro-2013-0004&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=23729617&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

71. Cousineau, J., Plateau, V., Baufreton, J. & Le Bon-Jego, M. Dopaminergic modulation of primary motor cortex: From cellular and synaptic mechanisms underlying motor learning to cognitive symptoms in Parkinson’s disease. Neurobiol Dis 167, 105674, doi:10.1016/j.nbd.2022.105674 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.nbd.2022.105674&link_type=DOI) 

72. Volta, M. & Melrose, H. LRRK2 mouse models: dissecting the behavior, striatal neurochemistry and neurophysiology of PD pathogenesis. Biochem Soc Trans 45, 113–122, doi:10.1042/BST20160238 (2017).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6NzoicHBiaW9zdCI7czo1OiJyZXNpZCI7czo4OiI0NS8xLzExMyI7czo0OiJhdG9tIjtzOjQ4OiIvYmlvcnhpdi9lYXJseS8yMDIzLzA0LzEwLzIwMjMuMDQuMDkuNTM2MTc4LmF0b20iO31zOjg6ImZyYWdtZW50IjtzOjA6IiI7fQ==) 

73. Vingill, S., Connor-Robson, N. & Wade-Martins, R. Are rodent models of Parkinson’s disease behaving as they should? Behav Brain Res 352, 133–141, doi:10.1016/j.bbr.2017.10.021 (2018).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.bbr.2017.10.021&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=29074404&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

74. Hussein, A., Tielemans, A., Baxter, M. G., Benson, D. L. & Huntley, G. W. Cognitive deficits and altered cholinergic innervation in young adult male mice carrying a Parkinson’s disease Lrrk2(G2019S) knockin mutation. Exp Neurol 355, 114145, doi:10.1016/j.expneurol.2022.114145 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.expneurol.2022.114145&link_type=DOI) 

75. Guevara, C. A. et al. LRRK2 mutation alters behavioral, synaptic, and nonsynaptic adaptations to acute social stress. J Neurophysiol 123, 2382–2389, doi:10.1152/jn.00137.2020 (2020).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1152/jn.00137.2020&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=32374202&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

76. Matikainen-Ankney, B. A. et al. Parkinson’s Disease-Linked LRRK2-G2019S Mutation Alters Synaptic Plasticity and Promotes Resilience to Chronic Social Stress in Young Adulthood. J Neurosci 38, 9700–9711, doi:10.1523/JNEUROSCI.1457-18.2018 (2018).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6Njoiam5ldXJvIjtzOjU6InJlc2lkIjtzOjEwOiIzOC80NS85NzAwIjtzOjQ6ImF0b20iO3M6NDg6Ii9iaW9yeGl2L2Vhcmx5LzIwMjMvMDQvMTAvMjAyMy4wNC4wOS41MzYxNzguYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9) 

77. Chen, C. et al. Pathway-specific dysregulation of striatal excitatory synapses by LRRK2 mutations. Elife 9, doi:10.7554/eLife.58997 (2020).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.7554/eLife.58997&link_type=DOI) 

78. Kuhlmann, N. & Milnerwood, A. J. A Critical LRRK at the Synapse? The Neurobiological Function and Pathophysiological Dysfunction of LRRK2. Front Mol Neurosci 13, 153, doi:10.3389/fnmol.2020.00153 (2020).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.3389/fnmol.2020.00153&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=32973447&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

79. Lim, J. et al. LRRK2 G2019S Induces Anxiety/Depression-like Behavior before the Onset of Motor Dysfunction with 5-HT(1A) Receptor Upregulation in Mice. J Neurosci 38, 1611–1621, doi:10.1523/JNEUROSCI.4051-15.2017 (2018).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6Njoiam5ldXJvIjtzOjU6InJlc2lkIjtzOjk6IjM4LzcvMTYxMSI7czo0OiJhdG9tIjtzOjQ4OiIvYmlvcnhpdi9lYXJseS8yMDIzLzA0LzEwLzIwMjMuMDQuMDkuNTM2MTc4LmF0b20iO31zOjg6ImZyYWdtZW50IjtzOjA6IiI7fQ==) 

80. Arbez, N. et al. G2019S-LRRK2 mutation enhances MPTP-linked Parkinsonism in mice. Hum Mol Genet 29, 580–590, doi:10.1093/hmg/ddz271 (2020).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1093/hmg/ddz271&link_type=DOI) 

81. Skiteva, O., Yao, N., Sitzia, G. & Chergui, K. LRRK2-G2019S mice display alterations in glutamatergic synaptic transmission in midbrain dopamine neurons. J Neurochem 161, 158–172, doi:10.1111/jnc.15588 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1111/jnc.15588&link_type=DOI) 

82. Lawal, O., Ulloa Severino, F. P. & Eroglu, C. The role of astrocyte structural plasticity in regulating neural circuit function and behavior. Glia 70, 1467–1483, doi:10.1002/glia.24191 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1002/glia.24191&link_type=DOI) 

83. Shani, V. et al. Physiological and pathological roles of LRRK2 in the nuclear envelope integrity. Hum Mol Genet 28, 3982–3996, doi:10.1093/hmg/ddz245 (2019).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1093/hmg/ddz245&link_type=DOI) 

84. Heaton, G. R. et al. Sequential screening nominates the Parkinson’s disease associated kinase LRRK2 as a regulator of Clathrin-mediated endocytosis. Neurobiol Dis 141, 104948, doi:10.1016/j.nbd.2020.104948 (2020).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.nbd.2020.104948&link_type=DOI) 

85. Matikainen-Ankney, B. A. et al. Altered Development of Synapse Structure and Function in Striatum Caused by Parkinson’s Disease-Linked LRRK2-G2019S Mutation. J Neurosci 36, 7128–7141, doi:10.1523/JNEUROSCI.3314-15.2016 (2016).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6Njoiam5ldXJvIjtzOjU6InJlc2lkIjtzOjEwOiIzNi8yNy83MTI4IjtzOjQ6ImF0b20iO3M6NDg6Ii9iaW9yeGl2L2Vhcmx5LzIwMjMvMDQvMTAvMjAyMy4wNC4wOS41MzYxNzguYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9) 

86. Baldwin, K. T. et al. HepaCAM controls astrocyte self-organization and coupling. Neuron 109, 2427–2442 e2410, doi:10.1016/j.neuron.2021.05.025 (2021).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.neuron.2021.05.025&link_type=DOI) 

87. Baptista, M. A. et al. Loss of leucine-rich repeat kinase 2 (LRRK2) in rats leads to progressive abnormal phenotypes in peripheral organs. PLoS One 8, e80705, doi:10.1371/journal.pone.0080705 (2013).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1371/journal.pone.0080705&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=24244710&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

88. Ness, D. et al. Leucine-rich repeat kinase 2 (LRRK2)-deficient rats exhibit renal tubule injury and perturbations in metabolic and immunological homeostasis. PLoS One 8, e66164, doi:10.1371/journal.pone.0066164 (2013).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1371/journal.pone.0066164&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=23799078&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

89. Daher, J. P., Volpicelli-Daley, L. A., Blackburn, J. P., Moehle, M. S. & West, A. B. Abrogation of alpha-synuclein-mediated dopaminergic neurodegeneration in LRRK2-deficient rats. Proc Natl Acad Sci U S A 111, 9289–9294, doi:10.1073/pnas.1403215111 (2014).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6NDoicG5hcyI7czo1OiJyZXNpZCI7czoxMToiMTExLzI1LzkyODkiO3M6NDoiYXRvbSI7czo0ODoiL2Jpb3J4aXYvZWFybHkvMjAyMy8wNC8xMC8yMDIzLjA0LjA5LjUzNjE3OC5hdG9tIjt9czo4OiJmcmFnbWVudCI7czowOiIiO30=) 

90. Miklavc, P. et al. Surfactant secretion in LRRK2 knock-out rats: changes in lamellar body morphology and rate of exocytosis. PLoS One 9, e84926, doi:10.1371/journal.pone.0084926 (2014).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1371/journal.pone.0084926&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=24465451&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

91. Taylor, M. & Alessi, D. R. Advances in elucidating the function of leucine-rich repeat protein kinase-2 in normal cells and Parkinson’s disease. Curr Opin Cell Biol 63, 102–113, doi:10.1016/j.ceb.2020.01.001 (2020).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.ceb.2020.01.001&link_type=DOI) 

92. Bonet-Ponce, L. & Cookson, M. R. LRRK2 recruitment, activity, and function in organelles. FEBS J 289, 6871–6890, doi:10.1111/febs.16099 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1111/febs.16099&link_type=DOI) 

93. Jeong, G. R. et al. Dysregulated phosphorylation of Rab GTPases by LRRK2 induces neurodegeneration. Mol Neurodegener 13, 8, doi:10.1186/s13024-018-0240-1 (2018).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1186/s13024-018-0240-1&link_type=DOI) 

94. Arranz, A. M. et al. LRRK2 functions in synaptic vesicle endocytosis through a kinase-dependent mechanism. J Cell Sci 128, 541–552, doi:10.1242/jcs.158196 (2015).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6NToiam9jZXMiO3M6NToicmVzaWQiO3M6OToiMTI4LzMvNTQxIjtzOjQ6ImF0b20iO3M6NDg6Ii9iaW9yeGl2L2Vhcmx5LzIwMjMvMDQvMTAvMjAyMy4wNC4wOS41MzYxNzguYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9) 

95. Martin, I. et al. Ribosomal protein s15 phosphorylation mediates LRRK2 neurodegeneration in Parkinson’s disease. Cell 157, 472–485, doi:10.1016/j.cell.2014.01.064 (2014).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.cell.2014.01.064&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=24725412&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000334304500019&link_type=ISI) 

96. Belluzzi, E. et al. LRRK2 phosphorylates pre-synaptic N-ethylmaleimide sensitive fusion (NSF) protein enhancing its ATPase activity and SNARE complex disassembling rate. Mol Neurodegener 11, 1, doi:10.1186/s13024-015-0066-z (2016).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1186/s13024-015-0066-z&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=26758690&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

97. Islam, M. S. et al. Human R1441C LRRK2 regulates the synaptic vesicle proteome and phosphoproteome in a Drosophila model of Parkinson’s disease. Hum Mol Genet 25, 5365–5382, doi:10.1093/hmg/ddw352 (2016).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1093/hmg/ddw352&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=27794539&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

98. Kalogeropulou, A. F. et al. P62/SQSTM1 is a novel leucine-rich repeat kinase 2 (LRRK2) substrate that enhances neuronal toxicity. Biochem J 475, 1271–1293, doi:10.1042/BCJ20170699 (2018).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6MTA6InBwYmlvY2hlbWoiO3M6NToicmVzaWQiO3M6MTA6IjQ3NS83LzEyNzEiO3M6NDoiYXRvbSI7czo0ODoiL2Jpb3J4aXYvZWFybHkvMjAyMy8wNC8xMC8yMDIzLjA0LjA5LjUzNjE3OC5hdG9tIjt9czo4OiJmcmFnbWVudCI7czowOiIiO30=) 

99. Nguyen, M. & Krainc, D. LRRK2 phosphorylation of auxilin mediates synaptic defects in dopaminergic neurons from patients with Parkinson’s disease. Proc Natl Acad Sci U S A 115, 5576–5581, doi:10.1073/pnas.1717590115 (2018).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6NDoicG5hcyI7czo1OiJyZXNpZCI7czoxMToiMTE1LzIxLzU1NzYiO3M6NDoiYXRvbSI7czo0ODoiL2Jpb3J4aXYvZWFybHkvMjAyMy8wNC8xMC8yMDIzLjA0LjA5LjUzNjE3OC5hdG9tIjt9czo4OiJmcmFnbWVudCI7czowOiIiO30=) 

100.Dhekne, H. S. et al. A pathway for Parkinson’s Disease LRRK2 kinase to block primary cilia and Sonic hedgehog signaling in the brain. Elife 7, doi:10.7554/eLife.40202 (2018).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.7554/eLife.40202&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=30398148&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

101.Lara Ordonez, A. J. et al. RAB8, RAB10 and RILPL1 contribute to both LRRK2 kinase-mediated centrosomal cohesion and ciliogenesis deficits. Hum Mol Genet 28, 3552-3568, doi:10.1093/hmg/ddz201 (2019).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1093/hmg/ddz201&link_type=DOI) 

102. Waschbusch, D. et al. Structural Basis for Rab8a Recruitment of RILPL2 via LRRK2 Phosphorylation of Switch 2. Structure 28, 406–417 e406, doi:10.1016/j.str.2020.01.005 (2020).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.str.2020.01.005&link_type=DOI) 

103.Gomez, R. C., Wawro, P., Lis, P., Alessi, D. R. & Pfeffer, S. R. Membrane association but not identity is required for LRRK2 activation and phosphorylation of Rab GTPases. J Cell Biol 218, 4157–4170, doi:10.1083/jcb.201902184 (2019).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6MzoiamNiIjtzOjU6InJlc2lkIjtzOjExOiIyMTgvMTIvNDE1NyI7czo0OiJhdG9tIjtzOjQ4OiIvYmlvcnhpdi9lYXJseS8yMDIzLzA0LzEwLzIwMjMuMDQuMDkuNTM2MTc4LmF0b20iO31zOjg6ImZyYWdtZW50IjtzOjA6IiI7fQ==) 

104.Herbst, S. et al. LRRK2 activation controls the repair of damaged endomembranes in macrophages. EMBO J 39, e104494, doi:10.15252/embj.2020104494 (2020).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.15252/embj.2020104494&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=32643832&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

105.Lee, H. et al. LRRK2 Is Recruited to Phagosomes and Co-recruits RAB8 and RAB10 in Human Pluripotent Stem Cell-Derived Macrophages. Stem Cell Reports 14, 940–955, doi:10.1016/j.stemcr.2020.04.001 (2020).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.stemcr.2020.04.001&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=32359446&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

106.Thiele, D. L. & Lipsky, P. E. Mechanism of L-leucyl-L-leucine methyl ester-mediated killing of cytotoxic lymphocytes: dependence on a lysosomal thiol protease, dipeptidyl peptidase I, that is enriched in these cells. Proc Natl Acad Sci U S A 87, 83–87, doi:10.1073/pnas.87.1.83 (1990).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6NDoicG5hcyI7czo1OiJyZXNpZCI7czo3OiI4Ny8xLzgzIjtzOjQ6ImF0b20iO3M6NDg6Ii9iaW9yeGl2L2Vhcmx5LzIwMjMvMDQvMTAvMjAyMy4wNC4wOS41MzYxNzguYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9) 

107.Takagawa, T. et al. An increase in LRRK2 suppresses autophagy and enhances Dectin-1-induced immunity in a mouse model of colitis. Sci Transl Med 10, doi:10.1126/scitranslmed.aan8162 (2018).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6MTE6InNjaXRyYW5zbWVkIjtzOjU6InJlc2lkIjtzOjE1OiIxMC80NDQvZWFhbjgxNjIiO3M6NDoiYXRvbSI7czo0ODoiL2Jpb3J4aXYvZWFybHkvMjAyMy8wNC8xMC8yMDIzLjA0LjA5LjUzNjE3OC5hdG9tIjt9czo4OiJmcmFnbWVudCI7czowOiIiO30=) 

108.Shutinoski, B. et al. Lrrk2 alleles modulate inflammation during microbial infection of mice in a sex-dependent manner. Sci Transl Med 11, doi:10.1126/scitranslmed.aas9292 (2019).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6MTE6InNjaXRyYW5zbWVkIjtzOjU6InJlc2lkIjtzOjE1OiIxMS81MTEvZWFhczkyOTIiO3M6NDoiYXRvbSI7czo0ODoiL2Jpb3J4aXYvZWFybHkvMjAyMy8wNC8xMC8yMDIzLjA0LjA5LjUzNjE3OC5hdG9tIjt9czo4OiJmcmFnbWVudCI7czowOiIiO30=) 

109.Bonello, F. et al. LRRK2 impairs PINK1/Parkin-dependent mitophagy via its kinase activity: pathologic insights into Parkinson’s disease. Hum Mol Genet 28, 1645–1660, doi:10.1093/hmg/ddz004 (2019).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1093/hmg/ddz004&link_type=DOI) 

110.Gan, L., Cookson, M. R., Petrucelli, L. & La Spada, A. R. Converging pathways in neurodegeneration, from genetics to mechanisms. Nat Neurosci 21, 1300–1309, doi:10.1038/s41593-018-0237-7 (2018).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/s41593-018-0237-7&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=30258237&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

111.Korecka, J. A. et al. Mitochondrial clearance and maturation of autophagosomes are compromised in LRRK2 G2019S familial Parkinson’s disease patient fibroblasts. Hum Mol Genet 28, 3232–3243, doi:10.1093/hmg/ddz126 (2019).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1093/hmg/ddz126&link_type=DOI) 

112.Hsieh, C. H. et al. Functional Impairment in Miro Degradation and Mitophagy Is a Shared Feature in Familial and Sporadic Parkinson’s Disease. Cell Stem Cell 19, 709–724, doi:10.1016/j.stem.2016.08.002 (2016).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.stem.2016.08.002&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=http://www.n&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

113.Toyofuku, T., Okamoto, Y., Ishikawa, T., Sasawatari, S. & Kumanogoh, A. LRRK2 regulates endoplasmic reticulum-mitochondrial tethering through the PERK-mediated ubiquitination pathway. EMBO J 39, e100875, doi:10.15252/embj.2018100875 (2020).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.15252/embj.2018100875&link_type=DOI) 

114.Inoshita, T. et al. Vps35 in cooperation with LRRK2 regulates synaptic vesicle endocytosis through the endosomal pathway in Drosophila. Hum Mol Genet 26, 2933–2948, doi:10.1093/hmg/ddx179 (2017).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1093/hmg/ddx179&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=28482024&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

115.Hur, E. M., Jang, E. H., Jeong, G. R. & Lee, B. D. LRRK2 and membrane trafficking: nexus of Parkinson’s disease. BMB Rep 52, 533–539 (2019).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.5483/BMBREP.2019.52.9.186&link_type=DOI) 

116.Parisiadou, L. et al. Phosphorylation of ezrin/radixin/moesin proteins by LRRK2 promotes the rearrangement of actin cytoskeleton in neuronal morphogenesis. J Neurosci 29, 13971–13980, doi:10.1523/JNEUROSCI.3799-09.2009 (2009).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6Njoiam5ldXJvIjtzOjU6InJlc2lkIjtzOjExOiIyOS80NC8xMzk3MSI7czo0OiJhdG9tIjtzOjQ4OiIvYmlvcnhpdi9lYXJseS8yMDIzLzA0LzEwLzIwMjMuMDQuMDkuNTM2MTc4LmF0b20iO31zOjg6ImZyYWdtZW50IjtzOjA6IiI7fQ==) 

117.Parisiadou, L. & Cai, H. LRRK2 function on actin and microtubule dynamics in Parkinson disease. Commun Integr Biol 3, 396–400, doi:10.4161/cib.3.5.12286 (2010).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.4161/cib.3.5.12286&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=21057624&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

118.Bretscher, A., Edwards, K. & Fehon, R. G. ERM proteins and merlin: integrators at the cell cortex. Nat Rev Mol Cell Biol 3, 586–599, doi:10.1038/nrm882 (2002).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/nrm882&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=12154370&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000177427600018&link_type=ISI) 

119.Gautreau, A., Louvard, D. & Arpin, M. Morphogenic effects of ezrin require a phosphorylation-induced transition from oligomers to monomers at the plasma membrane. J Cell Biol 150, 193–203, doi:10.1083/jcb.150.1.193 (2000).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6MzoiamNiIjtzOjU6InJlc2lkIjtzOjk6IjE1MC8xLzE5MyI7czo0OiJhdG9tIjtzOjQ4OiIvYmlvcnhpdi9lYXJseS8yMDIzLzA0LzEwLzIwMjMuMDQuMDkuNTM2MTc4LmF0b20iO31zOjg6ImZyYWdtZW50IjtzOjA6IiI7fQ==) 

120.Zhu, L. et al. High turnover of ezrin T567 phosphorylation: conformation, activity, and cellular function. Am J Physiol Cell Physiol 293, C874–884, doi:10.1152/ajpcell.00111.2007 (2007).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1152/ajpcell.00111.2007&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=17553936&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000249393600008&link_type=ISI) 

121.Endo, F. et al. Molecular basis of astrocyte diversity and morphology across the CNS in health and disease. Science 378, eadc9020, doi:10.1126/science.adc9020 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1126/science.adc9020&link_type=DOI) 

122.Kruyer, A., Scofield, M. D., Wood, D., Reissner, K. J. & Kalivas, P. W. Heroin Cue-Evoked Astrocytic Structural Plasticity at Nucleus Accumbens Synapses Inhibits Heroin Seeking. Biol Psychiatry 86, 811–819, doi:10.1016/j.biopsych.2019.06.026 (2019).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.biopsych.2019.06.026&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=31495448&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

123.Schacke, S. et al. Ezrin deficiency triggers glial fibrillary acidic protein upregulation and a distinct reactive astrocyte phenotype. Glia 70, 2309–2329, doi:10.1002/glia.24253 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1002/glia.24253&link_type=DOI) 

124.Zaman, R. et al. Effector-mediated ERM activation locally inhibits RhoA activity to shape the apical cell domain. J Cell Biol 220, doi:10.1083/jcb.202007146 (2021).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1083/jcb.202007146&link_type=DOI) 

125.Tsai, F. C. et al. Ezrin enrichment on curved membranes requires a specific conformation or interaction with a curvature-sensitive partner. Elife 7, doi:10.7554/eLife.37262 (2018).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.7554/eLife.37262&link_type=DOI) 

126.Viswanatha, R., Ohouo, P. Y., Smolka, M. B. & Bretscher, A. Local phosphocycling mediated by LOK/SLK restricts ezrin function to the apical aspect of epithelial cells. J Cell Biol 199, 969–984, doi:10.1083/jcb.201207047 (2012).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6MzoiamNiIjtzOjU6InJlc2lkIjtzOjk6IjE5OS82Lzk2OSI7czo0OiJhdG9tIjtzOjQ4OiIvYmlvcnhpdi9lYXJseS8yMDIzLzA0LzEwLzIwMjMuMDQuMDkuNTM2MTc4LmF0b20iO31zOjg6ImZyYWdtZW50IjtzOjA6IiI7fQ==) 

127.Korkmazhan, E. & Dunn, A. R. The membrane-actin linker ezrin acts as a sliding anchor. Sci Adv 8, eabo2779, doi:10.1126/sciadv.abo2779 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1126/sciadv.abo2779&link_type=DOI) 

128.Keo, A. et al. Cingulate networks associated with gray matter loss in Parkinson’s disease show high expression of cholinergic genes in the healthy brain. Eur J Neurosci 53, 3727-3739, doi:10.1111/ejn.15216 (2021).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1111/ejn.15216&link_type=DOI) 

129.Carbon, M., Felice Ghilardi, M., Dhawan, V. & Eidelberg, D. Correlates of movement initiation and velocity in Parkinson’s disease: A longitudinal PET study. Neuroimage 34, 361–370, doi:10.1016/j.neuroimage.2006.08.019 (2007).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.neuroimage.2006.08.019&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=17064939&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000242735300036&link_type=ISI) 

130.Ranchet, M. et al. Changes in Prefrontal Cortical Activity During Walking and Cognitive Functions Among Patients With Parkinson’s Disease. Front Neurol 11, 601686, doi:10.3389/fneur.2020.601686 (2020).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.3389/fneur.2020.601686&link_type=DOI) 

131.Oberheim, N. A. et al. Uniquely hominid features of adult human astrocytes. J Neurosci 29, 3276–3287, doi:10.1523/JNEUROSCI.4707-08.2009 (2009).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6Njoiam5ldXJvIjtzOjU6InJlc2lkIjtzOjEwOiIyOS8xMC8zMjc2IjtzOjQ6ImF0b20iO3M6NDg6Ii9iaW9yeGl2L2Vhcmx5LzIwMjMvMDQvMTAvMjAyMy4wNC4wOS41MzYxNzguYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9) 

132.Freeman, M. R. Specification and morphogenesis of astrocytes. Science 330, 774–778, doi:10.1126/science.1190928 (2010).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6Mzoic2NpIjtzOjU6InJlc2lkIjtzOjEyOiIzMzAvNjAwNS83NzQiO3M6NDoiYXRvbSI7czo0ODoiL2Jpb3J4aXYvZWFybHkvMjAyMy8wNC8xMC8yMDIzLjA0LjA5LjUzNjE3OC5hdG9tIjt9czo4OiJmcmFnbWVudCI7czowOiIiO30=) 

133.Baldwin, K. T. & Eroglu, C. Molecular mechanisms of astrocyte-induced synaptogenesis. Curr Opin Neurobiol 45, 113–120, doi:10.1016/j.conb.2017.05.006 (2017).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.conb.2017.05.006&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=28570864&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

134.Beccano-Kelly, D. A. et al. LRRK2 overexpression alters glutamatergic presynaptic plasticity, striatal dopamine tone, postsynaptic signal transduction, motor activity and memory. Hum Mol Genet 24, 1336–1349, doi:10.1093/hmg/ddu543 (2015).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1093/hmg/ddu543&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=25343991&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

135.Piccoli, G. et al. LRRK2 controls synaptic vesicle storage and mobilization within the recycling pool. J Neurosci 31, 2225–2237, doi:10.1523/JNEUROSCI.3730-10.2011 (2011).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6Njoiam5ldXJvIjtzOjU6InJlc2lkIjtzOjk6IjMxLzYvMjIyNSI7czo0OiJhdG9tIjtzOjQ4OiIvYmlvcnhpdi9lYXJseS8yMDIzLzA0LzEwLzIwMjMuMDQuMDkuNTM2MTc4LmF0b20iO31zOjg6ImZyYWdtZW50IjtzOjA6IiI7fQ==) 

136.Parisiadou, L. et al. LRRK2 regulates synaptogenesis and dopamine receptor activation through modulation of PKA activity. Nat Neurosci 17, 367–376, doi:10.1038/nn.3636 (2014).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/nn.3636&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=24464040&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

137.Ponzo, V. et al. Impaired intracortical transmission in G2019S leucine rich-repeat kinase Parkinson patients. Mov Disord 32, 750–756, doi:10.1002/mds.26931 (2017).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1002/mds.26931&link_type=DOI) 

138.West, et al. et al. Differential LRRK2 expression in the cortex, striatum, and substantia nigra in transgenic and nontransgenic rodents. J Comp Neurol 522, 2465–2480, doi:10.1002/cne.23583 (2014).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1002/cne.23583&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=24633735&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

139.Botta-Orfila, T. et al. Microarray expression analysis in idiopathic and LRRK2-associated Parkinson’s disease. Neurobiol Dis 45, 462–468, doi:10.1016/j.nbd.2011.08.033 (2012).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.nbd.2011.08.033&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=21946334&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

140.Helmich, R. C. et al. Reorganization of corticostriatal circuits in healthy G2019S LRRK2 carriers. Neurology 84, 399-406, doi:10.1212/wnl.0000000000001189 (2015).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1212/WNL.0000000000001189&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=25540317&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

141.Skelton, P. D., Tokars, V. & Parisiadou, L. LRRK2 at Striatal Synapses: Cell-Type Specificity and Mechanistic Insights. Cells 11, doi:10.3390/cells11010169 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.3390/cells11010169&link_type=DOI) 

142.Kaneko, T. & Fujiyama, F. Complementary distribution of vesicular glutamate transporters in the central nervous system. Neurosci Res 42, 243–250, doi:10.1016/s0168-0102(02)00009-3 (2002).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/S0168-0102(02)00009-3&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=11985876&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000175442000001&link_type=ISI) 

143.Fremeau, R. T., Jr. et al. The expression of vesicular glutamate transporters defines two classes of excitatory synapse. Neuron 31, 247–260, doi:10.1016/s0896-6273(01)00344-0 (2001).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/S0896-6273(01)00344-0&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=11502256&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000170277700010&link_type=ISI) 

144.Micheva, K. D., Busse, B., Weiler, N. C., O’Rourke, N. & Smith, S. J. Single-synapse analysis of a diverse synapse population: proteomic imaging methods and markers. Neuron 68, 639–653, doi:10.1016/j.neuron.2010.09.024 (2010).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.neuron.2010.09.024&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=21092855&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000285079500005&link_type=ISI) 

145.Chaudhry, F. A. et al. The vesicular GABA transporter, VGAT, localizes to synaptic vesicles in sets of glycinergic as well as GABAergic neurons. J Neurosci 18, 9733–9750, doi:10.1523/JNEUROSCI.18-23-09733.1998 (1998).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6Njoiam5ldXJvIjtzOjU6InJlc2lkIjtzOjEwOiIxOC8yMy85NzMzIjtzOjQ6ImF0b20iO3M6NDg6Ii9iaW9yeGl2L2Vhcmx5LzIwMjMvMDQvMTAvMjAyMy4wNC4wOS41MzYxNzguYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9) 

146.Tyagarajan, S. K. & Fritschy, J. M. Gephyrin: a master regulator of neuronal function? Nat Rev Neurosci 15, 141–156, doi:10.1038/nrn3670 (2014).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/nrn3670&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=24552784&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

147.Ippolito, D. M. & Eroglu, C. Quantifying synapses: an immunocytochemistry-based assay to quantify synapse number. J Vis Exp, doi:10.3791/2270 (2010).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.3791/2270&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=21113117&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

148.Glasgow, S. D., McPhedrain, R., Madranges, J. F., Kennedy, T. E. & Ruthazer, E. S. Approaches and Limitations in the Investigation of Synaptic Transmission and Plasticity. Front Synaptic Neurosci 11, 20, doi:10.3389/fnsyn.2019.00020 (2019).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.3389/fnsyn.2019.00020&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=31396073&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

149.Matsuzaki, M. et al. Dendritic spine geometry is critical for AMPA receptor expression in hippocampal CA1 pyramidal neurons. Nat Neurosci 4, 1086–1092, doi:10.1038/nn736 (2001).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/nn736&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=11687814&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000171970900011&link_type=ISI) 

150.Thaler, A. et al. Lower cognitive performance in healthy G2019S LRRK2 mutation carriers. Neurology 79, 1027–1032, doi:10.1212/WNL.0b013e3182684646 (2012).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1212/WNL.0b013e3182684646&link_type=DOI) 

151.Simuni, T. et al. Clinical and dopamine transporter imaging characteristics of non-manifest LRRK2 and GBA mutation carriers in the Parkinson’s Progression Markers Initiative (PPMI): a cross-sectional study. Lancet Neurol 19, 71–80, doi:10.1016/S1474-4422(19)30319-9 (2020).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/S1474-4422(19)30319-9&link_type=DOI) 

152.Thaler, A. et al. Altered reward-related neural responses in non-manifesting carriers of the Parkinson disease related LRRK2 mutation. Brain Imaging Behav 13, 1009–1020, doi:10.1007/s11682-018-9920-2 (2019).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1007/s11682-018-9920-2&link_type=DOI) 

153.Xenias, H. S. et al. R1441C and G2019S LRRK2 knockin mice have distinct striatal molecular, physiological, and behavioral alterations. Commun Biol 5, 1211, doi:10.1038/s42003-022-04136-8 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/s42003-022-04136-8&link_type=DOI) 

154.Schweimer, J. & Hauber, W. Involvement of the rat anterior cingulate cortex in control of instrumental responses guided by reward expectancy. Learn Mem 12, 334–342, doi:10.1101/lm.90605 (2005).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6ODoibGVhcm5tZW0iO3M6NToicmVzaWQiO3M6ODoiMTIvMy8zMzQiO3M6NDoiYXRvbSI7czo0ODoiL2Jpb3J4aXYvZWFybHkvMjAyMy8wNC8xMC8yMDIzLjA0LjA5LjUzNjE3OC5hdG9tIjt9czo4OiJmcmFnbWVudCI7czowOiIiO30=) 

155.Schweimer, J. & Hauber, W. Dopamine D1 receptors in the anterior cingulate cortex regulate effort-based decision making. Learn Mem 13, 777–782, doi:10.1101/lm.409306 (2006).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6ODoibGVhcm5tZW0iO3M6NToicmVzaWQiO3M6ODoiMTMvNi83NzciO3M6NDoiYXRvbSI7czo0ODoiL2Jpb3J4aXYvZWFybHkvMjAyMy8wNC8xMC8yMDIzLjA0LjA5LjUzNjE3OC5hdG9tIjt9czo4OiJmcmFnbWVudCI7czowOiIiO30=) 

156.Shenhav, A., Botvinick, M. M. & Cohen, J. D. The expected value of control: an integrative theory of anterior cingulate cortex function. Neuron 79, 217–240, doi:10.1016/j.neuron.2013.07.007 (2013).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.neuron.2013.07.007&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=23889930&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000322426200004&link_type=ISI) 

157.Hart, E. E., Blair, G. J., O’Dell, T. J., Blair, H. T. & Izquierdo, A. Chemogenetic Modulation and Single-Photon Calcium Imaging in Anterior Cingulate Cortex Reveal a Mechanism for Effort-Based Decisions. J Neurosci 40, 5628–5643, doi:10.1523/JNEUROSCI.2548-19.2020 (2020).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6Njoiam5ldXJvIjtzOjU6InJlc2lkIjtzOjEwOiI0MC8yOS81NjI4IjtzOjQ6ImF0b20iO3M6NDg6Ii9iaW9yeGl2L2Vhcmx5LzIwMjMvMDQvMTAvMjAyMy4wNC4wOS41MzYxNzguYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9) 

158.Tervo, D. G. R. et al. The anterior cingulate cortex directs exploration of alternative strategies. Neuron 109, 1876-1887 e1876, doi:10.1016/j.neuron.2021.03.028 (2021).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.neuron.2021.03.028&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=33852896&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

159.Brockett, A. T., Tennyson, S. S., deBettencourt, C. A., Gaye, F. & Roesch, M. R. Anterior cingulate cortex is necessary for adaptation of action plans. Proc Natl Acad Sci U S A 117, 6196–6204, doi:10.1073/pnas.1919303117 (2020).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6NDoicG5hcyI7czo1OiJyZXNpZCI7czoxMToiMTE3LzExLzYxOTYiO3M6NDoiYXRvbSI7czo0ODoiL2Jpb3J4aXYvZWFybHkvMjAyMy8wNC8xMC8yMDIzLjA0LjA5LjUzNjE3OC5hdG9tIjt9czo4OiJmcmFnbWVudCI7czowOiIiO30=) 

160.Tan, C. X., Burrus Lane, C. J. & Eroglu, C. Role of astrocytes in synapse formation and maturation. Curr Top Dev Biol 142, 371–407, doi:10.1016/bs.ctdb.2020.12.010 (2021).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/bs.ctdb.2020.12.010&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=33706922&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

161.Pelaseyed, T. & Bretscher, A. Regulation of actin-based apical structures on epithelial cells. J Cell Sci 131, doi:10.1242/jcs.221853 (2018).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6NToiam9jZXMiO3M6NToicmVzaWQiO3M6MTY6IjEzMS8yMC9qY3MyMjE4NTMiO3M6NDoiYXRvbSI7czo0ODoiL2Jpb3J4aXYvZWFybHkvMjAyMy8wNC8xMC8yMDIzLjA0LjA5LjUzNjE3OC5hdG9tIjt9czo4OiJmcmFnbWVudCI7czowOiIiO30=) 

162.Pelaseyed, T. et al. Ezrin activation by LOK phosphorylation involves a PIP(2)-dependent wedge mechanism. Elife 6, doi:10.7554/eLife.22759 (2017).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.7554/eLife.22759&link_type=DOI) 

163.Lombardo, A. T., Mitchell, C. A. R., Zaman, R., McDermitt, D. J. & Bretscher, A. ARHGAP18-Ezrin functions as a RhoA autoregulatory module in the organization of apical microvilli. bioRxiv, 2022.2009.2012.507663, doi:10.1101/2022.09.12.507663 (2022).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6NzoiYmlvcnhpdiI7czo1OiJyZXNpZCI7czoxOToiMjAyMi4wOS4xMi41MDc2NjN2MSI7czo0OiJhdG9tIjtzOjQ4OiIvYmlvcnhpdi9lYXJseS8yMDIzLzA0LzEwLzIwMjMuMDQuMDkuNTM2MTc4LmF0b20iO31zOjg6ImZyYWdtZW50IjtzOjA6IiI7fQ==) 

164.Broadhead, M. J. et al. Selective vulnerability of tripartite synapses in amyotrophic lateral sclerosis. Acta Neuropathol 143, 471–486, doi:10.1007/s00401-022-02412-9 (2022).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1007/s00401-022-02412-9&link_type=DOI) 

165.Moffat, J. et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell 124, 1283–1298, doi:10.1016/j.cell.2006.01.040 (2006).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.cell.2006.01.040&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=16564017&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000237241400026&link_type=ISI) 

166.Chih, B., Gollan, L. & Scheiffele, P. Alternative splicing controls selective trans-synaptic interactions of the neuroligin-neurexin complex. Neuron 51, 171–178, doi:10.1016/j.neuron.2006.06.005 (2006).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.neuron.2006.06.005&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=16846852&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000239535100005&link_type=ISI) 

167.Chen, F. & LoTurco, J. A method for stable transgenesis of radial glia lineage in rat neocortex by piggyBac mediated transposition. J Neurosci Methods 207, 172–180, doi:10.1016/j.jneumeth.2012.03.016 (2012).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1016/j.jneumeth.2012.03.016&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=22521325&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 
    
    [Web of Science](http://biorxiv.org/lookup/external-ref?access_num=000305669300006&link_type=ISI) 

168.O’Neil, S. D. et al. Action potential-coupled Rho GTPase signaling drives presynaptic plasticity. Elife 10, doi:10.7554/eLife.63756 (2021).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.7554/eLife.63756&link_type=DOI) 

169.Ferreira, T. A. et al. Neuronal morphometry directly from bitmap images. Nat Methods 11, 982–984, doi:10.1038/nmeth.3125 (2014).
    
    [CrossRef](http://biorxiv.org/lookup/external-ref?access_num=10.1038/nmeth.3125&link_type=DOI) 
    
    [PubMed](http://biorxiv.org/lookup/external-ref?access_num=25264773&link_type=MED&atom=%2Fbiorxiv%2Fearly%2F2023%2F04%2F10%2F2023.04.09.536178.atom) 

170.Uezu, A. et al. Identification of an elaborate complex mediating postsynaptic inhibition. Science 353, 1123–1129, doi:10.1126/science.aag0821 (2016).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6Mzoic2NpIjtzOjU6InJlc2lkIjtzOjEzOiIzNTMvNjMwNC8xMTIzIjtzOjQ6ImF0b20iO3M6NDg6Ii9iaW9yeGl2L2Vhcmx5LzIwMjMvMDQvMTAvMjAyMy4wNC4wOS41MzYxNzguYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9) 

171.Risher, W. C. et al. Thrombospondin receptor alpha2delta-1 promotes synaptogenesis and spinogenesis via postsynaptic Rac1. J Cell Biol 217, 3747–3765, doi:10.1083/jcb.201802057 (2018).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6MzoiamNiIjtzOjU6InJlc2lkIjtzOjExOiIyMTcvMTAvMzc0NyI7czo0OiJhdG9tIjtzOjQ4OiIvYmlvcnhpdi9lYXJseS8yMDIzLzA0LzEwLzIwMjMuMDQuMDkuNTM2MTc4LmF0b20iO31zOjg6ImZyYWdtZW50IjtzOjA6IiI7fQ==) 

172.Zhang, Y. et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. J Neurosci 34, 11929–11947, doi:10.1523/JNEUROSCI.1860-14.2014 (2014).
    
    [Abstract/FREE Full Text](http://biorxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6Njoiam5ldXJvIjtzOjU6InJlc2lkIjtzOjExOiIzNC8zNi8xMTkyOSI7czo0OiJhdG9tIjtzOjQ4OiIvYmlvcnhpdi9lYXJseS8yMDIzLzA0LzEwLzIwMjMuMDQuMDkuNTM2MTc4LmF0b20iO31zOjg6ImZyYWdtZW50IjtzOjA6IiI7fQ==)