Abstract
Cancer stem cells (CSCs) are known to potentiate tumor initiation and maintenance in oral squamous cell carcinoma (OSCC). Increasing evidences suggest that CD44highCD24low population in OSCC exhibit CSC-like characteristics. The role of mi-RNAs in maintenance of oral CSCs has remained unclear. Here we report that CD44highCD24low population within OSCC cell lines and primary HNSCC tumors have an elevated expression of miR-146a. Moreover, over-expression of miR-146a results in enhanced stemness phenotype by augmenting CD44highCD24low population. We demonstrate that miR-146a induces CSC property by stabilizing β-catenin with concomitant loss of E-cadherin and CD24. Interestingly, CD24 has been identified as a novel functional target of miR-146a and ectopic expression of CD24 abrogates miR-146a driven potential CSC phenotype. Mechanistic analysis reveals that higher CD24 levels inhibit AKT phosphorylation leading to β-catenin degradation in non-CSCs. We also validate that the miR-146a/CD24/AKT loop significantly alters tumorigenic ability in vivo. Furthermore, we confirmed that β-catenin trans-activates miR-146a, thereby forming a positive feedback loop contributing to stem cell maintenance. Collectively, our study demonstrates that miR-146a regulates CSC-driven properties in OSCC through CD24-AKT-β-catenin axis.
Introduction
Oral Squamous Cell Carcinoma (OSCC) is the most prevalent form of head and neck cancers worldwide with more than 60% individuals diagnosed with advanced tumors1. It is known that cancer stem-like cells (CSC) leads to aggressive tumor behavior 2. The oral tumor CSCs are also considered responsible for treatment failures, relapse and development of metastases 3,4. Over the past decade, epigenetic re-programming has emerged as a crucial mechanism of regulating cancer stem cell dynamics 5. Epigenetic regulatory mechanisms include DNA methylation, histone modifications and chromatin remodeling. They show robust effect upon cellular fate and stem cell potential 6,7. MiRNAs, a small ncRNAs of 20-22 nucleotides, has recently gained considerable importance in epigenetic modulation of tumor 8. De-regulation of miRNAs may have critical roles in disease development 9. They can act either as oncogenes or as tumor-suppressors depending upon the specific genes targeted. In-fact miRNA associated signatures are now considered for cancer specific diagnostic and prognostic purposes 10.
MiRNAs not only regulate primary cellular functions like proliferation, differentiation, migration and invasion, but are also directly or indirectly involved in CSC functions 11–14. Most of this phenomenon are attributed to altered signaling pathways including cell surface markers, pluripotent transcription factors, chemo-resistance and epithelial-to-mesenchymal transition (EMT) markers15.Role of miR-34a, miR-145a and miR-200bc family in regulating CD44, Oct4, Sox2, KLF4, Bmi1, Zeb1/2 and Notch1 has been well established16–19. Thus, by precisely regulating the CSC related genes, miRNAs themselves have emerged as inherent modulators of cancer stem cells.MiR-146a is predominantly an onco-miR, which directly targets IRAK1, traf6, and numb genes in OSCC and imparts tumorigenicity 20.Emerging evidence on miR-146a suggests that it directs the self-renewal process in colorectal cancer stem cells by regulating Snail-β-catenin axis which also contributes to EMT21. High nuclear accumulation of β-catenin, along with lowering of E-cadherin is frequently associated with higher tumor grade and poor prognosis in various cancers22. Given the role of Wnt/β-catenin signaling in CSC maintenance and the miRNAs in regulating wnt pathway, understanding the step-wise regulation of its mediators is crucial 23–25.
Our recent study has characterized CD44highCD24low cells as the potential CSC population in OSCC3. CD24, a small cell surface protein, was identified as a critical determinant of differentiation in hematopoietic cells and mammary epithelial cells26. Besides having role in adhesion, cadherin switching or migration, CD24 is involved in diverse signaling networks, thus promoting oncogenesis or regression27. Although role of CD44 is well established4, the significance of CD24 in determining stemness is less explored, particularly in oral CSCs. In this study, we show that miR-146a imparts CD44highCD24lowstatus to OSCC cells merely by targeting CD24. Changes in β-catenin pools seemed to be an important event in altering the afore-mentioned phenotypes downstream of miR-146a through AKT pathway. We propose that miR-146a/CD24/AKT/β-catenin axis influences the stemness characteristics of CD44highCD24low population in oral cancer cells.
Results
MiR-146a is over-expressed in CD44highCD24low population of OSCC cell lines and primary tumors
To identify the cellular miRNAs regulating CSC phenotype of OSCC cells, we initially screened nine miRNAs that are aberrantly expressed in human cancers with their reported role in cancer stemness and EMT 30–32. QRT-PCR data showed significant difference in the expression of miR-200b, miR-138, miR-34a, miR-21 and miR-146a betweenCD44highCD24low and CD44lowCD24high population of SCC25 cells (Fig. 1a). Amongst them, we focused on miR-146a in view of its context dependent role in various cancers33–35.MiR-146a is consistently over-expressed in oral CSCs, therefore it was intriguing to explore its possible connection with stemness and the underlying mechanisms. Up-regulation of miR-146a in the CD44highCD24low population of SCC131 and SCC084 cell lines was also confirmed (Fig. 1b). Further, miR-146a expression was also increased upon enrichment of isolated CSCs in the sphere forming culture conditions, suggesting its importance in determining oral CSC property (Fig. 1c). Increased miR-146a expression has been reported to predict poor survival of OSCC patients20. Our analyses in TCGA Head and Neck Squamous cell Carcinoma (HNSCC) patient’s cohort36, showed increased miR-146a expression in patients with CD44highCD24lowsignature compared to those with CD44lowCD24highprofile (Fig. 1d). While there was not much difference in the histological stage of the tumors across the two categories, most of the CD44lowCD24high tumors were free of lymph node metastasis (Figure S1a, Supplementary file 1). Moreover, miR-146a expression of the node positive patients was relatively higher than that of the node negative ones, although not statistically significant (Figure S1b). Together, our data suggests high miR-146a expression as a critical determinant of CSC phenotype in oral tumors.
Ectopic expression of miR-146a induces CSC characteristics
We next investigated whether ectopic miR-146a affect CSC markers and found a significant increase in the relative proportion ofCD44highCD24low population in SCC131 cells (Fig. 2a). Similar results were also obtained with SCC036, SCC084 and SCC25 cells, respectively (Figure S2a). Characteristic sphere forming ability of miR-146a expressing SCC131 and SCC036 cells were also markedly enhanced (Fig. 2b). Concomitantly, ectopic expression of miR-146a led to the increased expression of intracellular stem cell markers such as Oct4, Sox2 and C-myc and loss of Involucrin (Fig. 2c). Also, we observed a pronounced decrease in CD24 protein levels upon ectopic miR-146a expression in SCC036, SCC131 and SCC084 cells (Fig. 2c). However, in SCC131 cells the levels of Oct4 and Involucrin did not show a dose dependent change upon miR-146a over-expression, probably due to high endogenous miR-146a in this cell line (Fig. 2c and Figure S2b). Loss of these markers upon knockdown of miR-146a was also evident in SCC131 and SCC25 cells (Figure S2c). Expression of miR-146a transcripts was validated by qRT-PCR (Figure S2d). Transfection of miR-146a containing mutated seed sequence, however, did not alter the levels of stem-related proteins in a statistically significant manner (Fig. 2d).These results demonstrate that miR-146a contributes to enrichment of CSCs in OSCC through increased expression of stem cell markers.
MiR-146a activates Wnt/β-catenin pathway and promotes EMT in oral CSCs
The CSC population is sustained by niche signalling, similar to that of normal stem cells. These include Wnt, Notch and Hedgehog pathways that are often involved in maintaining its self-renewal potential 37. Accordingly, we observed increased expression of β-catenin and Cleaved Notch1 in CD44highCD24low population of SCC25 and SCC131 cells (Figure S3a, b).While significantly depleted in CD24highcells, β-catenin levels were also higher in CD24low population of SCC084 cells which correlated well with the expression of stemness markers in these cells (Fig. 3a). To specifically envisage the role of CD24, we now compared the CD44highCD24low population with the CD44highCD24high cells only. Interestingly we detected nuclear localization of β-catenin in the CD44highCD24low population of SCC131 cells, whereas it remained membrane bound in CD44highCD24highcells(Fig. 3b). Transcriptional activity of β-catenin was indicated by the relative wnt reporter activity in the respective cell populations (Figure S3c). Interestingly, upon stable knockdown of β-catenin, not only the stem cell markers were reduced but also a modest increase in CD24 expression was observed (Figure S3d). These results suggest a possible cross talk between CD24 and β-catenin in conferring stemness and EMT to these cells.
The clue that β-catenin level might influence stemness in OSCC cells led us to investigate whether miR-146a regulates β-catenin. Indeed, over-expression of miR-146a lead to the dose dependent increment in β-catenin levels with concordant decrease in E-cadherin (Fig. 3c). It is known that miR-146a targets the 3’UTR of Numb, a protein that promotes lysosomal degradation of β-catenin and Cleaved Notch1 38.We indeed, confirmed reduced levels of Numb upon miR-146a over-expression along with stabilization of Cleaved Notch1(Figure S3e). Conversely, inhibition of miR-146a activity lead to β-catenin degradation along with the loss of Oct4 as expected (Fig. 3d). Notably, we did not observe these changes upon mutant miR-146a over-expression (Figure S3f). To emphasize the contribution of β-catenin in miR-146a induced stemness, we transfected miR-146a in β-catenin shRNA expressing cells and found no change in expression of CSC markers (Figure S3g) as compared to that of non-silencing controls. Strikingly, the ability of anchorage independent growth induced by miR-146a was also dependent on the expression of β-catenin (Figure S3h) suggesting its tumorigenic role in OSCC.
To obtain clinical relationships among miR-146a, CD24 and β-catenin, we first checked the correlation between miR-146a and CD24expression across the NCI-60 cell lines and found it to be significantly negatively correlated (Fig. 3e). Moreover, examination of CD44high HNSCC tumors from TCGA dataset revealed a positive correlation between miR-146a expression and β-catenin/CD24 ratio (Fig. 3f). Further, the observed down-regulation of E-cadherin upon miR-146a expression prompted us to address the miR-146a driven EMT phenomenon in OSCC. Indeed, miR-146a was found to be significantly over-expressed in the mesenchymal (MS) cell lines showing higher CD44 and lower CD24 expression3, compared to the epithelial (EP) cell lines of the NCI-60 panel29(Fig. 3g). In addition, the miR-146a expression in TCGA tumor samples was negatively correlated with the E-cadherin to Vimentin ratio (Fig. 3h). Based on these observations, we propose that miR-146a induced stemness and EMT in OSCC is mediated through lowering of CD24 followed by activation of β-catenin.
MiR-146a targets CD24 in oral CSCs
We considered CD24 as a putative target of miR-146a through which it might impart stemness in OSCC. Although, in silico identification of miRNA targets using the prediction software did not reveal CD24 as the probable target, we did find matching of miR-146a seed sequence in the CD24 3’UTR in miRANDA (Supplementary file 2). Despite one mismatch, the maximum free energy of miRNA-mRNA binding was favourable enough for hybridization and targeting (Figure S4a). In Fig. 2c, we had already examined that CD24 expression was significantly depleted upon miR-146a transfection in a dose dependent manner in SCC036, SCC131 and SCC084 cells. Alongside, it was up-regulated upon inhibition of miR-146a in SCC131 cells (Fig. 4a). We also observed remarkable changes in CD24 transcripts in both SCC131 and SCC084 upon modulation of miR-146a (Fig. 4b,c).To further confirm that CD24 is a direct target of miR-146a, we co-transfected luciferase reporter vector containing the 3’UTR fragment of CD24 gene with either miR-146a expressing vector or anti-miR-146a in SCC131 cells. As shown in Fig. 4d, e and f, miR-146a over-expression reduced the luciferase activity of CD24 3’UTR, while miR-146a inhibitor elevated the same. On the contrary, transfection with mutated mir-146a did not alter the CD24 3’UTR luciferase activity significantly (Fig. 4d, Figure S4b). Thus, this data experimentally validates the ability of miR-146a to directly target CD24 gene by binding to its 3’UTR. This justifies the involvement of miR-146a in negative regulation of CD24 expression in oral cancer stem cells.
Mir-146a stabilizes β-catenin by down-regulating CD24
To get a mechanistic insight into the miR-146a mediated β-catenin stabilization, CD24 was over-expressed in miR-146a over-expressing cells. Interestingly, CD24 not only abolished the stemness markers but also the expression of β-catenin and CD44 (Fig. 5a and FigureS5a).This indicated that down-regulation of CD24 by miR-146a was instrumental in maintaining the high β-catenin levels and consequently the downstream stemness phenotype. This was further exemplified as CD24 over-expression alone could lead to degradation of β-catenin protein and the associated stem cell markers, while the siRNA mediated knockdown of CD24 showed an opposite effect (Fig. 5b,c). Wnt target genes such as C-myc, CD44, CCND1 were detected at conspicuous levels upon CD24 knockdown, whereas significantly depleted upon CD24 over-expression in cells expressing miR-146a (Figure S5b, c). These observations suggest an inverse correlation between CD24 and β-catenin signalling in OSCC cells. It was further confirmed by the inhibition of miR-146a-induced β-catenin nuclear mobilization upon ectopic expression of CD24 (Figure S5d). In addition, miR-146a driven increased wnt reporter activity was found to be reduced upon CD24 over-expression (Fig.S5e). To further investigate its downstream effect on stemness phenotype, we performed an in vitro sphere-formation assay. We observed a considerably defective spheroid forming ability of miR-146a transfected cells in the presence of CD24 (Fig.S5f). Together, these observations suggest the possible contribution of CD24 in regulating Wnt pathway through β-catenin, thereby affecting CSC-like traits.
Involvement of pAKT in CD24 mediated degradation of β-catenin
Next, to elucidate the cause of β-catenin reduction in the presence of CD24, we treated SCC084 and SCC036 cells with MG132, and found β-catenin levels returned to that of un-transfected controls (Fig. 5d). This confirms that unlike Numb, CD24 degrades β-cateninin a proteasomally dependent manner. The restored β-catenin also re-established the expression of stem cell marker Oct4 irrespective of CD24 over-expression in both SCC036 and SCC084 cells (Fig. 5d). E-cadherin levels, however, remained high in the presence of CD24, irrespective of β-catenin stability (Fig. 5d). Notably, CD24 did not affect Numb expression, corroborating the independent participation of CD24 in regulating β-catenin (Figure S6a). To gain mechanistic insights into the CD24 mediated β-catenin degradation, we speculated that CD24 might sequester β-catenin into the membrane bound lipid rafts analogous to that of E-cadherin39. To address this, we checked the CD24 and β-catenin interaction at protein level but did not found them in co-immunoprecipitation (Figure S6b). Alternatively, CD24 may also lead to β-catenin destabilization via AKT-GSK-3β pathway40,41. Towards this, we did find that CD24 over-expression rescued the miR-146a mediated increase in pAKT (Ser 473) activity (Fig. 5e). Here it was appreciably noted that over-expression of CD24 lead to the down-regulation of total AKT protein itself and thereby phopho-AKT (Figure S6c), although it remained stable during MG132 treatment (Figure S6d). On the contrary, knockdown of CD24 in SCC036 increased pAKT and β-catenin levels (Fig. 5f). Moreover, pAKT was found to be accumulated in the CD44highCD24low fraction of SCC25 cells thereby indicating its prior involvement in stemness (Figure S6e). In addition, we observed significant depletion of β-catenin upon treatment with pAKT inhibitor (LY294002) which again confirmed its regulation by miR-146a-CD24-pAKT loop (Fig. 5g).
These cell line related observations was further validated using mouse xenograft model. To check the effect of miR-146a on in-vivo tumor formation, SCC084 cells harboring either an empty vector (SCC084/EV) or stably expressing miR-146a (SCC084/miR-146a), were generated and the over-expression of miR-146a with subsequent downregulation of CD24 was confirmed by both qRT-PCR and western blot analysis (Fig. S7a, b and c). SCC084/EV and SCC084/miR-146a cells were then introduced in the right and left flanks of NOD/SCID mice respectively and allowed to form subcutaneous tumor (Fig S7d and e). A significant increase in tumor volume and tumor weight was observed in SCC084 xenografts stably over-expressing miR-146asuggesting enhanced stemness potential of these cells. (Fig 6a and b). Further, to explore the effect of AKT signaling on miR-146a induced tumor, mice with palpable tumors generated from SCC084/EV and SCC084/miR-146a cells were treated with quercetin, a known PI3K/AKT signalling pathway blocker 42 (Fig S7d and e). As expected, the tumor formation ability of miR-146a cells was significantly attenuated in vivo upon administration of quercetin at regular intervals (Fig 6a and b). While there was no effect of quercetin on miR-146a and CD24 levels, β-catenin over-expression in miR-146a tumors was compromised in presence of quercetin (Fig S7f, g). In order to investigate the effect of CD24 upon the acquired stemness of miR-146a expressing cancer cells in vivo, we examined xenograft tumors generated from SCC084/miR-146a cells harboring CD24 expression construct (Fig S7a, b, c, h and i). Notably, compared to the control tumors, volume and weight of CD24expressingSCC084/miR-146a tumors were not significantly (p-value = 0.7360) altered (Fig 6c and d) suggesting loss of miR-146a driven stemness. Xenograft tumor subjected to qRT-PCR analysis confirms the overexpression of miR-146a and CD24 in these cells while β-catenin is down-regulated (Fig.S7j and k). Collectively, these results indicate that CD24/AKT/β-catenin axis plays an important role in miR-146a regulated CSC-mediated tumor growth in-vivo. This was further supported by the soft agar tumorigenesis assays, which clearly showed that CD24 over-expression or AKT inhibition, both rescued the miR-146a induced colony formation in OSCC cells (Fig. S8a and b). The above results strongly prove CD24 as a negative regulator of ß-catenin/Wnt signaling pathway through AKT inhibition.
β-catenin transactivates miR-146a expression contributing to positive feedback loop
The upstream regulators of miRNAs have always been involved in feedback regulatory mechanisms and are not much investigated. Analysis of miR-146a promoter has revealed the binding sites for NF-κB, TCF4/β-catenin and STAT3, suggesting possible transcriptional modulation21,43,44.β-catenin enhances stemness features by driving the intracellular levels of c-myc and other yamanaka factors (Fig. 7a). This apparently contributes to the enhanced tumorigenic properties in response to high miR-146a levels. Interestingly, we found that β-catenin also promotes the expression of miR-146a, which might augment the stemness acquiring ability of the cancer cells (Fig. 7a). However, expression of miR-146a was significantly reduced in the presence of both dnTCF4 and Numb which inhibits β-catenin binding to the promoter and degrades it respectively (Fig. 7b). Change in miR-146a promoter activity under similar conditions suggests that β-catenin is involved in trans-activation of miR-146a promoter (Figure S9a). We hypothesize that β-catenin mediated induction of miR-146a contributes to β-catenin mediated CD24 reduction (Fig. 7a). ChIP-qPCR assay confirmed that β-catenin binds to miR-146a promoter in vivo (Fig. 7c). Further, the recruitment of β-catenin was found to be significantly enhanced in absence of CD24 (Fig. 7c). Moreover, miR-146a promoter activity was significantly increased in presence of miR-146a, while reduced upon ectopic expression of CD24 (Fig. 7d). However, the constructs with either mutated or deleted TCF4 binding sites showed no significant difference in promoter activity (Figure S9b). This may be due to the alternating levels of β-catenin which shoots up in miR-146a over-expression condition and gets depleted in presence of CD24. Transient ChIP assays with the same luciferase constructs also confirmed that β-catenin indeed binds to miR-146a promoter, which is impeded upon CD24 over-expression (Fig. 7e). These data positively confirm the feedback activation loop by β-catenin that further trans-activates miR-146a expression to shift the equilibrium towards CSC maintenance.
Discussion
Oral cancer progression has been largely attributed to both genetic and epigenetic heterogeneity. Tumorigenic cells can arise from the non-tumorigenic cancer cells owing to spontaneous conversion to a stem-like state45. The origin and plasticity of such cells, called cancer stem cells (CSCs), have always been a matter of debate. Nevertheless, CSCs are known to be responsible for chemo-resistance, tumor recurrence and metastasis. Detail molecular characterization of CSCs is therefore of paramount importance for eliminating them from its roots. CD24 has been routinely used with CD44 for the prospective isolation of CSCs in colorectal, prostate and breast cancers 46. Given the critical role of cellular miRNAs in regulating CSC characteristics, current anticancer therapies have provided an important avenue towards exploiting them for effective cellular targeting47. Targeting of CD44 by miRNAs in NSCLC, prostate and ovarian cancer has been previously demonstrated to attenuate stemness17,48,49. However, miRNA mediated regulation of CD24 remains to be determined.
Consistent with its oncogenic functions, miR-146a promotes symmetric division of colorectal CSCs, thereby promoting stemness 21. The miRNA is also involved in development of melanoma by activating Notch1 signaling leading to drug resistance 50. However, little is known about its role in regulating expression of CSC-related CD markers in oral cancer. In the present study, we detected significantly higher expression of miR-146a in CD44highCD24low population of OSCC cell lines as well as in tumor specimens. We therefore speculated whether miR-146a expression maintains CSC traits or miR-146a accumulation is a consequence of induced stemness. Notably, ectopic expression of miR-146a induce CSC-phenotype i.e. CD44highCD24low population together with increased β-catenin activity in OSCC cell lines. CD44 is a well-known transcriptional target of β-catenin along with C-myc and CCND121, which clearly indicates a molecular link with miR-146a induced CD44 expression. However the effect of miR-146a upon CD24 expression under these conditions was particularly intriguing. Hence, we examined whether CD24 is a direct target of miR-146a and experimentally confirmed that miR-146a binds to the 3’UTR of CD24 thereby repressing it post-transcriptionally. Loss of E-cadherin upon miR-146a over-expression and positive correlation with the mesenchymal marker vimentin was also evident. Hence, in addition to its novel role in acquiring stemness, our results re-confirmed miR-146a as a key regulator of EMT51.
Wnt/β-catenin has shown great potential for CSC-targeting in cancer37. Our study shows that CSC characteristics in OSCC is attributed to the elevated β-catenin along with depleted CD24. The anticipation that CD24 leads to proteasomal degradation of β-catenin was found to be true and apparently it also abolished the β-catenin mediated stemness. This is a novel functional interaction through which miR-146a regulates β-catenin in oral cancer cells. Our study, thus points towards the tumor-suppressor functions of CD24, supporting our previous observation of reduced CD24 expression in oral tumors compared to the normal tissue (our own data) 3. Although growth inhibition was achieved by knocking down CD24 in colorectal and pancreatic cancer52, no such effects were observed in oral cancer. Perhaps the variable cell-type specific distribution pattern underlies the paradoxical role of CD24 in oral cancer53. Activated PI3K-AKT pathway is one of the primary events in carcinogenesis54. Its contribution to stem cell self-renewal and proliferation (both normal and cancer) has also been extensively studied55. Receptor Tyrosine Kinase (RTKs) mediated growth signals (through EGF, IL-6, TGF-ß etc.) impinges upon AKT through activation of the PI3K kinase56. Stability of phospho-AKT and other kinases play key role in maintaining cancer stem cells of chronic myeloid leukemia (CML), NSCLC, breast, prostate and colorectal cancer55. Further, signaling pathways like WNT are often linked with AKT activation that eventually contribute to expression of stem cells-related factors, chemo-resistance genes, and CSC markers54,57. Here we show that CD24, the cell surface CSC marker lie upstream of AKT protein, similar to that of TWIST and FOXO transcription factors which is also known to inhibit CD2440,58–60. However, the precise mechanism by which expression/stability of AKT protein is regulated by CD24 is unknown.CD24 has been shown to possibly modulate phospho-AKT levels 61, which might affect its downstream targets such as GSK-3ß41. Activated GSK-3ß mediates phosphorylation and ubiquitination of β-catenin, thereby leading to its degradation 41. Therefore, it was incumbent on us to ask whether CD24 induce AKT and subsequently affect β-catenin stability in miR-146a induced oral CSCs. Indeed, MG132 treatment was found to re-stabilize β-catenin by relieving pAKT inhibition in cells over-expressing CD24. Moreover, direct AKT inhibition in the miR-146a transfected cells depleted β-catenin, irrespective of CD24 level suggesting AKT is downstream of CD24. Thus, we logically elucidated the molecular mechanism underlying CD24 mediated β-catenin degradation in oral cancer cells. We have specifically shown that CD24 over-expression decrease levels of phospho-AKT leading to β-catenin instability. The role of miR-146a/CD24/AKT/β-catenin axis in maintaining the oral cancer stem cell populations is thus mechanistically evident. Studies from in-vivo tumor model system also confirms that these molecular mechanisms directly affect tumorigenesis.
Further, the recruitment of β-catenin onto miR-146a promoter was found to be negatively regulated by CD24 which might contribute to the fine tuning of stemness. These results clearly establish a cross-regulatory network between miR-146a and β-catenin, governed by a stem-related marker, CD24 in OSCC cells. Our study thus provides strong evidences which suggest that miR-146a promotes CSC characteristics of oral cancer cells by down-regulating CD24. Repression of CD24 leads to AKT stabilization followed by activation of Wnt/β-catenin signaling. Based on our observation, we propose a model wherein, AKT activity is an important determinant of miR-146a dependent β-catenin signaling (Fig. 8). It should be noted, however, that β-catenin mediated CSC induction might be due to the induction of miR-146a expression or vice-versa. Taken together, the present study highlights a novel mechanism of miR-146a mediated self-renewal capacity of Oral CSCs that may have a prognostic or therapeutic value in oral cancer.
Materials and methods
Cell culture and transfection
Various human Oral Squamous Cell Carcinoma (OSCC) cell lines SCC131, SCC084 and SCC036 were obtained from Dr. Sussane Gollin, University of Pittsburgh. These cells were maintained in 5% CO2 at 37°C in DMEM medium supplemented with 10% fetal bovine serum (FBS) and antibiotics (Life Technologies, Thermo Fisher Scientific Inc., MA, USA). The ATCC (American Type Culture Collection) oral cancer cell line, SCC25 was cultured in complete DMEM-F12 medium and 400ng/ml Hydrocortisone (Sigma Aldrich) under similar conditions. For transfection, Lipofectamine™ 2000 (Invitrogen) was used in serum free medium. Transfected cells were harvested after 48 hrs or 72 hrs for over-expression or knockdown studies respectively.
Plasmid constructs, miRNA inhibitors and siRNAs
We obtained mir-146a and mir-146a SDM expressing pU61 construct from Dr. Nitai. P. Bhattacharjee (SINP, Kolkata). The TOP-flash/FOP-flash reporters, dnTCF4, Numb, and pcDNA3.1 empty vector along with miR-146a promoter LucA, LucB and mLucA Luciferase constructs were kind gifts from Muh-Hwa Yang (Taiwan). Human CTNNB1 expression plasmid deposited by Eric Fearon was purchased from Addgene (#16828). CD24 cDNA cloned into the pCDNA3.1 vector and the full-length 3’-UTR of CD24 cloned into the HindIII site of pMIR (Ambion) were obtained from Heike Allgayer (University of Heidelberg, Germany). Anti-miR-146a (AM-34a) (ID: AM11030) were obtained from Ambion, CD24 siRNA (a pool of 3 target specific siRNAs) and Scramble siRNA from Santa Cruz. CTNNB1 shRNA constructs (Addgene # 18803) were provided by Dr. Mrinal Kanti Ghosh, IICB, Kolkata. MiR-146a over-expression cassette was sub-cloned from pU61 into the pLKO.1 TRC vector (Addgene plasmid # 10878). Packaging plasmids psPAX2 (Addgene plasmid # 12260) and pMD2.G (Didier Trono, Addgene plasmid# 12259) was used to generate the miR-146a over-expression lentiviral particles and target cells were infected following the manufacturer's protocol. Stable transduced cells were selected by puromycin (Gibco) and over-expression efficiencies were verified by qRT-PCR and western blotting. CD24 was co-transfected and clones were selected by G418.
Quantitative Real Time PCR
TRIzol (Invitrogen, Thermo Fisher Scientific Inc., MA USA) method was used for isolation of total RNA as per manufacturer’s instructions. 250 ng of RNA were converted to cDNAs using stem-loop primers specific for reverse transcription of individual miRNAs28. MiRNA cDNAs were amplified with forward primers specific for individual miRNAs and a URP, with U6 snRNA as an endogenous reference control. For mRNA expression changes, protocol was similar to that described previously 3. SYBR Green master mix (Roche, USA) was used to carry out qRT-PCR in the 7500 Fast Real-Time PCR instrument (Applied Biosystems, USA). Fold change values (2−ΔΔCT) were calculated from average of three independent experiments. Primer sequences of genes, miRNA forward and loop primers are listed in Supplementary File 3.
Analysis of TCGA and NCI-60 datasets
RNA and miRNA-seq data were acquired for a total of 292 HNSCC tumor specimens from TCGA (The Cancer Genome Atlas) data portal (https://tcga-data.nci.nih.gov/tcga/). We first grouped top 25% of CD44 high and low expressing tumors and then further sub-grouped 25% of these tumors based on CD24 expression (Supplementary File 1). These were designated as CD44highCD24low and CD44lowCD24high, wherein we checked the differential expression of miR-146a and calculated statistical significance using R Limma Package. Node status of these patients was also correlated with miR-146a expression using GraphPad Prism5 software. NCI-60 miRNA expression dataset (GEO accession number GSE26375) was analyzed to compare the miR-146a expression between the epithelial and mesenchymal groups as classified earlier 29 using Mann Whitney’s u test.
Flow cytometry
Briefly, 48 hours post transfection of miR-146a, approximately 1×106 cells were harvested in 1X PBS consisting of 1% FBS and 0.02% sodium azide. CD44-PE and CD24-FITC (BD Pharmingen) conjugated antibodies were used for double staining. Cells were then washed and subjected to flow cytometry on the BD LSRFortessa and analysis was done using BD FACSDiva 6.2 software. Debris and clumps were excluded and the size gate was decided using forward and side scatter analysis of unstained cells. Isotype controls were included for the non-specific staining.
Sphere forming assay
MiR-146a transfected cells were cultured overnight. Next day, cells were trypsinised and a single cell suspension was ensured. Low attachement 6-well plate were used for re-seeding the cells at a density of 5000 cells/ml in DMEM-F-12 serum free media containing 1% B27 supplement, 20 ng/ml of EGF and 20 ng/ml of bFGF (Invitrogen). 500 μl of media was added every 2-3 days. Photographs of the spheres were taken under inverted microscope (Leica TCS SP8; Germany) with 20X magnification at 7-14 days. All experiments were done in biological triplicates.
Immuno-fluorescence
Sorted populations of SCC131 were grown on cover-slips overnight and then fixed with chilled aceto-methanol (1:1). 0.03% Saponin (Calbiochem, Germany) was used for permeabilization followed by blocking with 3% BSA. Rabbit monoclonal antibody against β-catenin and mouse monoclonal antibody against CD24, CD44 (Cell signaling technology) were added at a dilution of 1:200 and incubated overnight. It was then probed with anti-rabbit-FITC and anti-mouse Alexa-Flour 633nm conjugated secondary antibody (molecular probes) and counter stained with DAPI (Invitrogen) for nuclear staining. Images were taken under a confocal microscope (Andor Spinning Disc Confocal Microscope, Andor Technology, Belfast, Ireland) at 60X magnification.
Western blotting
Cell lysates were prepared after 48 hrs of transfection in NP-40 lysis buffer (Invitrogen) and protease inhibitor cocktail (1X) was added for enhanced protein stability. Bradford reagent (Sigma) was used to determine concentrations and equivalent amounts of denatured protein samples were subjected to SDS-PAGE (8%-10%), separated by size and transferred on to PVDF membrane (Millipore, Billerica, USA). Antibodies used for immuno-blotting were polyclonal β-catenin, E-cadherin, CD44 and CD24, Involucrin (Santa Cruz Biotechnology, CA, USA), polyclonal Oct4 and Sox2 (Abcam), polyclonal C-myc, Akt and phospho-Akt (Cell Signaling Technology, USA). Bands were obtained using ECL substrate (Thermo Scientific, USA) from HRP-conjugated secondary antibody (Sigma). Proteasome Inhibitor MG132 (Calbiochem) and Akt inhibitor LY294002 (Cell signaling Technology, USA) were both used at a concentration of 50 μM. Transfected cells were treated for 4 hours before harvesting. Band intensities of each protein were analyzed by ImageJ to obtain densitometric values for their quantification. These were normalized to β-actin for individual experimental sets and fold change calculated. All the histograms were expressed as means ± S.D. of three different experiments and p values computed in GraphPad Prism 5 (Student’s two tailed t test).
In vivo tumor xenograft experiments
Animal experiments were performed following guidelines of the institutional animal ethics committee of National Centre for Cell Science, Pune. All the animals were issued under the project IAEC/2012/B183. To investigate the effect of miR-146a overexpression on Oral squamous cell carcinoma (OSCC) growth in vivo, 3×106 empty vector- and microRNA overexpression construct-containing SCC084 cells were injected subcutaneously into the dorsal flanks of eight NOD/SCID male mice (18 weeks old) on left and right side respectively. When palpable tumors could be seen the mice were segregated into groups of four each. Mice in one of the groups were injected with 25 mg/kg of body weight of Quercetin (Sigma) on every alternate day for a period of 15 days. The experiment was terminated when the average miR-146a over-expressing SCC084 tumor volumes in the group which received no quercetin reached about 1200 mm3. At the termination of the experiment, the animals were sacrificed by CO2 asphyxiation and the tumors were collected for further analysis. Tumor diameters were measured each time the Quercetin was injected and at the termination of the experiment using digital Vernier Caliper. Excised tumor tissues were weighed and then stored in RNAlater solution (ThermoFisher Scientific) in −20°C freezer. Tumor volumes were determined using the following formula: π/6[(d1×d2)3/2]; where d1 and d2 are two different diameters of a tumor. In another experiment, to investigate effect of simultaneous overexpression of miR-146a and CD24 on OSCC growth in vivo, 3×106 empty vector- and miR-146a and CD24 overexpression constructs-containing OSCC-084 cells were injected subcutaneously into the dorsal flanks of four NOD/SCID male mice (15 weeks old) on left and right side respectively. Tumors volumes were measured when palpable growth could be observed. The experiment was terminated when tumor volumes reached 1300 mm3. The animals were euthanized by CO2 asphyxiation and the tumors were collected. Tumor tissues were processed as described previously for the other experiment.
Reporter assays
Cells seeded in 24 well plates were co-transfected with miR-146a OE plasmid and either CD24 3’UTR or miR-146a promoter luciferase construct using LipofectamineTM 2000 (Invitrogen). The TOP-Flash and FOP-Flash reporters were also used under similar conditions. Promega dual luciferase assay system was performed according to the manufacturer’s protocol. After 48 hr of transfection, medium was washed off with 1x PBS and cells were lysed with Passive Lysis Buffer (Promega) and luminescence was measured in Promega Glomax 20/20 luminometer. The luminescence values were transfection normalized with the internal control pRL-TK (50 ng, Renilla Luciferase; Promega). Experiments were performed with three biological replicates.
Chromatin immunoprecipitation
Cells seeded in 10cm dishes were transfected. After 48hrs, 1X formaldehyde solution was added for DNA-protein crosslinking. Cells were lysed in SDS lysis buffer followed by sonication in Bioruptor (Diagenode) to obtain 200-1000 bp chromatin fragments. ChIP dilution buffer was used to dilute the sheared chromatin followed by preclearing with Protein G Agarose beads (Sigma) for 30min. After preclearing, 20% of the lysate was kept aside as the input and the remaining was divided equally for IP and IgG. Immunoprecipitation was carried out using 5μg of β-catenin (Santa Cruz) and normal IgG control (Sigma) and incubated overnight. The following day, Protein G Agarose beads were added to collect the Antibody/Antigen/Chromatin complex. The complex was washed briefly with cold low salt immune complex wash followed by high salt immune complex buffer, lithium chloride immune complex buffer and Tris-EDTA buffer. It was then reverse-crosslinked and the DNA purified using Phenol/Chloroform extraction method. PCR amplification of the immunoprecipitated DNA was carried out using primers listed in Supplementary File 1. Composition of the ChIP buffers are provided in Supplementary Information.
Statistical analyses
Three different experiments were subjected to an independent two-tailed Student's t test to measure the significance value of results under varying biological parameters. R package was used to generate the correlation graphs and calculate p values. * indicates P ≤ 0.05 and ** indicates P ≤ 0.01.
Author contributions
SG and SR conceived and designed the study. Some experiments were designed by DG and SD. Experiments, data collection and statistical analyses were performed by SG, DG, SD and PD. Some experiments were performed by RB and MG. The manuscript was written and edited by SG, DG, SD, GC and SR. All authors read and approved the final manuscript.
Conflict of interest
The authors declare that they have no conflict of interest.
ChIP Primers
Endogeneous miR-146a promoter
146A_P2_F: CCCAAGTAGCTGGGACTACA
146A_P2_R: TAGGCGAGATGTGGTGACTC
Luciferase miR-146a promoter
TBS-chip_F CTTGAATGTTCACATTTCCAGAG
TBS-chip_R GGCAGAAAGCTCCCTTGTTTC
Acknowledgements
We thank Prof. Nitai. P. Bhattacharjee (SINP), Dr. Muh-Hwa Yang (National Yang-Ming University, Taiwan) and Dr. Heike Allgayer (University of Heidelberg, Germany) for providing us the necessary plasmids. We thank Dr. Raghunath Chatterjee (Indian Statistical Institute, Kolkata, India) for performing the RNA-hybrid analysis in miRANDA software. We thank Tanmoy Dalui and Diptadeep Sarkar (CSIR-Indian Institute of Chemical Biology, Kolkata, India) for helping us with FlowCytometry and Confocal Microscopy respectively. We thank Dr. Arindam Datta (CSIR-Indian Institute of Chemical Biology, Kolkata, India) for assisting TCGA and NCI-60 dataset analysis. The work was supported by CSIR—Mayo Clinic Collaboration for Innovation and Translational Research Grant CMPP-08 and J.C. Bose National Fellowship grant JCB/2017/000005 awarded to S. Roychoudhury. S.G, D.G and P.D. are supported by fellowship from the Council of Scientific and Industrial Research (New Delhi, India). Mouse experiments and SD, RB and MG are supported by CSIR-fellowship in NCCS, Pune.