Abstract
Dorsal-ventral pattern formation of the neural tube is regulated by temporal and spatial activities of extracellular signalling molecules. Sonic hedgehog (Shh) assigns ventral neural subtypes via activation of the Gli transcription factors. Shh activity changes dynamically during neural differentiation, but the mechanisms responsible for regulating this dynamicity are not fully understood. Here we show that the P2Y-type G-protein coupled receptor GPR17 is involved in temporal regulation of the Shh signal. GPR17 was expressed in the ventral progenitor regions of the neural tube and acted as a negative regulator of the Shh signal in chick embryos. While the activation of the GPR17-related signal inhibited ventral identity, perturbation of GPR17 expression led to aberrant expansion of ventral neural domains. Notably, perturbation of GPR17 expression partially inhibited the negative feedback of Gli activity. Moreover, GPR17 increased cAMP activity, suggesting that it exerts its function by inhibiting the processing of Gli3 protein. GPR17 also negatively regulated Shh signalling in neural cells differentiated from mouse embryonic stem cells, suggesting that GPR17 function is conserved among different organisms. Our results demonstrate that GPR17 is a novel negative regulator of Shh signalling in a wide range of cellular contexts.
Author Summary During neural development, determination of cell fate and the progress of differentiation are regulated by extracellular signal molecules, including Sonic Hedgehog (Shh). Shh forms a gradient within the embryonic organ of the central nervous system, or the neural tube, and a variety of cells are produced corresponding to the concentration. While the signal concentration is critical for cell fate, recent studies have revealed that the intracellular signal intensity does not always correspond to the Shh concentration. Rather, the intracellular signal intensity changes over time. Importantly, the signal intensity peaks and gradually decreases thereafter, and the half-life of the Shh signal contributes to the cell fate determination. However, the mechanisms for this temporal change are not fully understood.
By using chick embryos and mouse embryonic stem cells as model systems, we demonstrate that the G-protein coupled receptor, GPR17, is an essential regulator for the negative feedback of the Shh signal during neural development. While GPR17 gene expression is induced by the Shh signal, GPR17 perturbs the Shh signalling pathway. This negative function of GPR17 on the Shh signal is conserved among different vertebrate species. The collective data demonstrate that GPR17 is a negative regulator for the Shh signalling pathway in a wide range of the cellular contexts.
Introduction
The neural tube, the embryonic organ of the central nervous system, consists of neural progenitors and post-mitotic neurons arrayed in an orderly manner [1,2]. During neural tube development, extracellular signalling molecules (“morphogens”) produced in the signalling centres of the organ provide positional cues to uncommitted neural progenitor cells, and thereby assign the cellular fates in a concentration-dependent manner [3]. Identifying the molecular mechanism by which cells convert positional information into fate determination is one of the major goals of developmental biology.
Sonic hedgehog (Shh) is a signalling molecule expressed in the floor plate (FP) of the neural tube and its underlying mesodermal tissue, the notochord. Shh plays essential roles in the assignment of ventral identities [3]. At the cellular level, Shh ligand binds to the 12-span transmembrane protein Patched 1 (Ptch1) at the primary cilia. The binding activates another membrane protein, Smoothened (Smo). Smo further activates the transcription factors Gli2/3, which are transported into the nucleus to induce the expression of their target genes [3]. Gli2 and Gli3 have dual activities; in the absence of Shh, the precursor Gli2/3 proteins associate with the scaffold protein SuFu to form complexes with Cullin3 and Protein Kinase A (PKA), and are phosphorylated and proteolytically processed into their repressor forms [4-7]. In response to the Shh ligand, these complexes are dissociated, ubiquitination is perturbed, and Gli2/3 are converted into their active forms [7-9].
In the spinal cord, Shh forms a ventral-to-dorsal gradient with the highest level in the FP, and is required for the assignment of at least five ventral neural progenitor domains in addition to FP [1,3]. The ventral domains include p0-p2, pMN, p3 that are arrayed in this order from dorsal to ventral, and can be defined by transcription factors expressed in a domain-specific manner. For instance, two transcription factors Olig2 and Nkx2.2 are expressed in the pMN and p3 domains, respectively, and are essential for these identities [10-12]. During the neural tube development, Olig2 responds to Shh and is expressed first, and the expression of Nkx2.2, which is also a responsive gene to Shh, expression begins later [13]. The higher concentration of Shh allows the quicker switch of the progenitor cells from Olig2- to Nkx2.2-expressing state [14]. In this manner, the progenitor cells exposed to a higher Shh concentration form the Nkx2.2-positive p3 domain at a more ventral position than the Olig2/pMN domain. Thus, the concentration of Shh is converted into the dynamic expression of the transcription factors and determines the cell fates in the spinal cord [15].
The Gli activity partially reflects the concentration of Shh at the initial step of neural differentiation [14]. After it is initially elevated, however, Gli activity decreases over time [14,15]. Moreover, the half-life of the signal intensity determines the kinetics of the conversion of the downstream transcription factors that characterise the neural domains. Therefore, the dynamic change in Gli activity, which is termed temporal adaptation, is important for correct pattern formation of the neural tube [13-16].
Multiple mechanisms have been proposed to explain this adaptation [17]. One model involves upregulation of the Ptch1 gene. Since Ptch1 is a negative regulator of the Shh signal, accumulation of Ptch1 depletes Shh and consequently decreases its intracellular signalling activity [13]. Another model proposes that the temporal decrease in the level of Gli2, which is a mediator protein of the Shh signal, decreases over time, suggesting that the transduction of the Shh signal is reduced as the neural development proceeds [17]. Importantly, this adaptation takes place only in the context of the neural differentiation, and not in cultured cells, such as NIH3T3 fibroblast cells [1,17,18], suggesting that some key genes are specifically induced in a developmental context. However, such regulators have yet to be identified.
In parallel with Shh activity, intracellular cyclic AMP (cAMP) level and the activity of the downstream mediator PKA have critical roles for the neural tube pattern formation [5,19]. Absence of PKA activity affects the subcellular localisation and processing of Gli proteins at the cellular level, and results in the expansion of the ventral domains of the neural tube [5]. Likewise, the activity of adenylyl cyclase 5 and 6 (AC5 and AC6, respectively), which encourage the production of cAMP by resolving adenosine triphosphate (ATP), affects the Gli activity and determination of the ventral cell fate [20,21]. Moreover, G-protein coupled receptors (GPCRs) have been suggested to control the neural tube pattern formation through regulating the intracellular cAMP level [18,22]. GPCRs couple with G-proteins that are comprised of Gα, Gβ and Gγ subunits. G-proteins are categorised into several subclasses based on the type of the Gα protein; Gαs and Gαq can potentiate the cAMP level, whereas Gαi decreases this level [23]. With respect to the neural tube development and Shh signal, GPR161 has been suggested to interact with Gαs and negatively regulates the ventral neural identities by elevating the cAMP level [24]. Conversely, GPR175 interacts with Gαi protein and enhances the Shh signal [25]. Therefore, the GPCR/cAMP/PKA axis is a critical regulatory pathway in the neural tube pattern formation. However, the mechanisms by which cAMP/PKA activity is involved in the temporal changes of Gli activity remain to be revealed.
In this study, we hypothesised the existence of a GPCR regulated by the Shh signal. To identify GPCRs induced by Shh, we performed a quantitative RT-PCR (RT-qPCR)-based screen in chick neural explants, and identified GPR17 as a candidate gene. GPR17 is induced by Shh, but negatively regulates the Shh signal, making it an example of negative feedback. GPR17 also functions as a negative regulator in neural differentiation of mouse embryonic stem (ES) cells. Taken together, our findings demonstrate that GPR17 is a negative regulator in multiple cellular contexts.
Results
GPR17 is expressed in the ventral region of the neural tube
To identify genes involved in Shh signal dynamics, we focused on GPCRs, as many GPCRs regulate the activity of PKA and further modify the processing of Gli transcription factors, their activities [21]. With this in mind, we selected genes of GPCRs that can bind to Gαs or Gαq, and performed a screen that combined RT-qPCR and in situ hybridisation (S1 Fig) to isolate the GPCR that responds to Shh. Based on its expression pattern and responsiveness to Shh, we identified the P2Y-like GPCR (a group of GPCRs that take purine as ligand) GPR17 as a candidate. In situ hybridisation analysis revealed that GPR17 is expressed broadly in the ventral region of the trunk neural tube at Hamburger-Hamilton (HH) stage 14 (Fig 1A). At HH stage 24, the expression formed a dorsal-to-ventral gradient in the progenitor region of the neural tube, with the lowest level at the dorsal region and highest level at Olig2-positive pMN and Nkx2.2-positive p3 regions, which are motor neuron and V3 interneuron progenitor regions, respectively (Fig 1B and 1C) [2]. In addition, while the GPR17 expression was found in a wide area in the ventral at the beginning of the neural tube development (Fig 1A), the floor plate expression was abolished as development progressed (Fig 1B and 1C). In addition, while the expression of GPR17 occurred in a wide area in the ventral region at the beginning of the neural tube development (Fig 1A), the floor plate expression halted as development progressed (Fig 1B and 1C).
To investigate the relationship between Shh and GPR17 expression, we performed an ex vivo analysis using intermediate neural explants. We isolated neural progenitor cells from the preneural tube area [26] of HH stage 9 embryos and cultured the cells for 48 hours in the presence of low or high concentrations of Shh (ShhL and ShhH, respectively), which determine motor neuron and floor plate identities, respectively (S2 Fig). Expression levels of GPR17 were measured by RT-qPCR, every 12 hours up to 48 hours (Fig 1D). At 12 hours, GPR17 expression was higher in explants treated with ShhL or ShhH than in untreated explants (Fig 1D), and this trend continued at 24 and 36 hours. By contrast, at 48 hours, expression was downregulated in explants treated with ShhH, but remained high in explants treated with ShhL. This finding is consistent with the in vivo expression pattern of abolished expression in the floor plate (Fig 1A).
Next we explored the upstream transcription factors that induce GPR17 expression. Since GPR17 requires Olig1 for its expression [27] and is one of the target genes of Olig2 during oligodendrocyte development [28], we assessed if the overexpression of an Olig-type transcription factors could induce the GPR17 transcript. To address this, we prepared intermediate neural explants that were electroporated with the Olig2 expression plasmid, and determined the GPR17 expression level by RT-qPCR. GPR17 expression was elevated at 24 hours, suggesting that Olig2 alone is sufficient to induce GPR17 expression (Fig 1E, lanes 1 and 2). By contrast, FoxA2, which is expressed in the floor plate, downregulated GPR17 (Fig 1E, lanes 1 and 3), which was consistent with the observation that the GPR17 expression was lower in the floor plate region. Znf488 (also known as Zfp488), which is expressed in the same regions as Olig2 [29,30], did not have a significant effect on GPR17 expression (Fig 1E, lanes 1 and 4). These data supported the idea that GPR17 expression is targeted by Olig2 [28], and becomes exclusive to the floor plate as development progresses.
The collective results suggested that GPR17 expression is mainly regulated by Shh signal and its downstream transcription factor Olig2. This intriguing regulation of GPR17 expression prompted us to further investigate its role in neural tube development.
GPR17 is a negative regulator of the Shh signalling pathway
We sought to characterise the molecular role of GPR17 in the Shh signalling pathway. For this purpose, we first analysed the subcellular localisation of GPR17 by immunohistochemistry in NIH3T3 cells (Fig 2A-2D’). GPR17 was detected throughout the cells (Fig 2B) when GPR17 primary antibody was added (Fig 2A and 2B). The distribution of the GPR17 signal did not change upon treatment with Shh (Fig 2C) or its agonist SAG (Fig 2D) [31]. Importantly, while the intracellular signal transduction induced by Shh is mediated by the cilia, GPR17 was not significantly localised to the ciliary shaft or its surrounding areas in any conditions (Fig 2A’, 2B’, 2C’, 2D’).
Next, to examine the effect of GPR17 in the Shh intracellular signalling pathway, cells transfected with either yellow fluorescent protein (YFP) or GPR17-YFP were treated with SAG for 24 hours. RT-qPCR analysis was conducted to assay the expression of Ptch1 and Gli1, which are primary target genes of the Shh signal [17] (Fig 2E). The extent of the upregulation of these genes in GPR17-transfected cells was significantly lower than in the control cells (Fig 2E). Given that SAG targets the Smo protein [31], this result suggests that GPR17 perturbs the intracellular Shh signal downstream of Smo.
We therefore assessed if the reduction of the target genes of the Shh signal resulted at the step of Gli processing by examining the accumulation of Gli3 protein in cells. Gli3, a critical mediator of the Shh signalling pathway [32], is a dual-mode transcription factor with the ubiquitinated and truncated repressor form and the full-length form that can be active by further modifications [7,8,33,34]. Moreover, it has been suggested that the altered ratio of the amounts of the full-length and repressor form, as well as the total amount of the protein, changes upon the exposure to Shh or its related signals [18]. Therefore, we attempted to determine whether this ratio was affected by the overexpression of GPR17. We prepared control-YFP or GPR17-YFP-transfected cells that were untreated or treated with SAG and examined them by western blots using the Gli3 antibody (Fig 2F). Without SAG treatment, the ratio of the full-length over the repressor form of Gli3 was not changed by the transfection of GPR17 (Fig 2F, lanes 1 and 2). By contrast, when cells were treated with SAG, Gli3FL became less abundant while the amount of Gli3R was less affected, consistent with the previous report that Gli3 is destabilised by the Shh signal [18] (Fig 2F, lane 3 and Fig 2G). However, in the GPR17-YFP-expressing cells, the change in Gli3FL was less than that of the control cells (Fig 2F, lane 4 and Fig 2G), suggesting that the effect of SAG on Gli3 was perturbed by the presence of GPR17.
We further measured the cAMP levels in the cells, because modification of Gli3 proteins depends on the intracellular cAMP level [6]. Cells were transfected with control vector or the plasmid conveying cGPR17 (chicken GPR17) and treated with 3-isobutyl-1-methylxanthine (IBMX), a non-competitive selective phosphodiesterase inhibitor, to raise the basal level of intracellular cAMP (Fig 2H). GPR161 was used as a positive control [24]. A higher cAMP level was evident in GPR17 cells than in control cells (Fig 2H). To further support the idea that the cAMP level was upregulated in the GPR17-expressing cells, we conducted a reporter assay measuring the activity of the cAMP-responsive element-binding region (CREB). Transfection of both cGPR17 and mGPR17 (mouse GPR17) expression plasmids raised the CREB activity, confirming that the intracellular cAMP level was raised upon the overexpression of GPR17 (Fig 2I).
Taken together, these findings demonstrated that GPR17 functions as a negative regulator of the Shh signalling pathway by upregulating cAMP levels.
GPR17 negatively regulates the ventral identity of the neural tube
To investigate the activity of GPR17 in neural tube development and pattern formation, we overexpressed GPR17 by in ovo electroporation in the neural tube of the chick embryos, and monitored its effect on dorsal-ventral pattern formation. However, pattern formation was not significantly altered (0/7 embryos; S4A-S4C” Fig). This could be because a trigger, such as a ligand, is necessary to activate GPR17-mediated signalling, with the overexpression of GPR17 alone not being sufficient to fully activate the receptor.
Therefore, we speculated that the combination of GPR17 with its specific agonist, MDL29951 [35,36], would embody the phenotype of the GPR17 overexpression, and attempted to administrate the chemical on the embryos. To administer MDL29951 to embryos, we employed New culture system, in which embryos were cultured from HHs stage 12 ex ovo to maintain the concentration of the chemical throughout the culture [37] (Fig 3A-3D). In the control condition, the embryos displayed expression of Olig2 (Fig 3A) and Pax7 (Fig 3C) in the ventral and dorsal regions, respectively, after 36 hour-culture. By contrast, when the embryos were cultured in the presence of MDL29951, the expression of Olig2 was reduced (Fig 3B) and Pax7 was expanded ventrally (Fig 3D), suggesting the dorsal-ventral pattern was affected by the compound.
Next, in order to reveal the relationship between the intracellular Shh signal and GPR17 more directly, we investigated the effect of GPR17 and MDL29951 on the forced activation of the Shh signal. We electroporated the constitutively-active form of Smo (SmoA1) [38] at HH stage 12 and found that the neural tube was highly ventralised at 48 hours post transfection (hpt), with a strong expansion of the Nkx2.2-positive region and the repression of the Pax7-positive area (S3A-S3B”, S3FS3G” Fig). The administration of MDL29951 to the SmoA1-electroporated embryos (S3C-S3C”, S3HS3H” Fig) did not change the trend, suggesting that the concentration of MDL29951 used was not sufficient to influence the Shh signal activated by Smo. The co-electroporation of GPR17 with SmoA1 also did not change the expansion of the ventralisation (S3D-S3D”, S3I-S3I” Fig). However, when the same amount of MDL29951 was administered to SmoA1 and GPR17 electroporated neural tubes, the extent of the ventral expansion was significantly reduced (S3E-S3E” Fig), and the number of electroporated cells expressing Pax7 increased (S3J-S3J”, S3K Fig). The results suggest that MDL29951 synergistically works with GPR17 and that the activation of GPR17-mediated signal perturbs the intracellular Shh signalling pathway induced by Smo. Moreover, it is unlikely that the alteration of the pattern formation is mediated by the programmed cell death, as a TdT-mediated dUTP nickend labelling (TUNEL) assay did not detect a significantly increased number of positive signals (S3L-S3M’ Fig).
We further investigated the direct effect of GPR17 on the Shh signalling pathway by an intermediate neural explant analysis. Because the GPR17 expression was induced by Shh at 24 hours in the explants (Fig 1D, S1 Fig), we expected that the treatment with MDL29951 on the explants would alter the neural identities. ShhH treatment of the explants for 24 hours simulated the differentiation into ventral neural progenitor cells. Nkx2.2 expression was detectable in the majority of cells, and Olig2 in a smaller subset (4 areas; Fig 3E, 3G 3I, 3K). By contrast, when the explants were treated with MDL29951 along with ShhH, the number of cells expressing Nkx2.2 decreased, whereas the number of Olig2-positive cells increased (4 areas; Fig 3F, 3H, 3J, 3K). Given that the Olig2-expressing cells can be induced by ShhL, whereas Nkx2.2 expression is induced by ShhH in 24-hour cultures [13], the results suggest that Shh was partially inhibited by the GPR17-associated signalling. This effect occurred independently from the programmed cell death, as the increasing number of TUNEL-positive cells was not found (S3N-P Fig).
To confirm that Shh activity was decreased by GPR17-mediated signalling, we performed a reporter assay to measure Gli activity. We prepared pools of explants transfected with the GBS-Luc reporter construct, which harboured the luciferase gene driven by the Gli binding sequence (GBS). The luciferase activity was measured after 24 hours. As the result, Gli activity was significantly upregulated by ShhH (Fig 3L lanes 1 and 2). However, when MDL29951 was added along with ShhH, the activity was reduced to a level close to that of explants cultured with the ShhL (more than four pools of explants in each condition; Fig 3L lanes 2-4). These data confirmed that the Gli activity was perturbed by GPR17 and its related signals.
We attempted to further investigate if the activation of the GPR17-related signal correlated with the elevation of the intracellular cAMP level, by assaying intermediate neural explants. Consistent with the previous observation, the cAMP level in the explants treated with Shh for 24 hours showed a lower cAMP level than in the control explants (Fig 3M, lanes 1 and 2) [18,21,39]. However, in the explants treated with MDL29951 in combination with Shh, the cAMP level was restored (Fig 3M, lanes 1 and 3). The observations suggested that MDL29951 perturbed the Shh-mediated decrease in the cAMP level.
Together, these findings suggested that the GPR17-mediated signalling pathway negatively regulates Shh activity in the context of neural tube pattern formation through the upregulation of the intracellular cAMP level.
Perturbation of GPR17 expression causes aberrant expansion of ventral progenitor domains
To further investigate the functions of GPR17 in the development of neural tube pattern formation, we employed a loss-of-function approach. For this purpose, we designed a siRNA and a shRNA targeting GPR17 (si-GPR17 and sh-GPR17), and carried out in ovo electroporation into the neural tube.
We first electroporated si-GPR17 into neural tubes at HH stage 11. At 48 hpt, we observed aberrant expansion of the ventral neural domains characterised by Olig2, Nkx2.2 and FoxA2 (8 embryos for si-control; 10 embryos for si-GPR17; Fig 4A-4F”). Moreover, probably because the low level expression of GPR17 was perturbed by si-GPR17, the area positive for Pax7 expressed in the dorsal progenitor domains was diminished (Fig 4G-4H”). This finding suggested that GPR17 per se is a negative regulator of the Shh signal, and that the expansion of ventral neural regions was caused by perturbation of GPR17 expression. This aberrant expression was abolished by co-electroporation of mouse GPR17, which is not targeted by si-GPR17 (6 embryos for each; S4D-S4F” Fig), suggesting that the phenotype observed in si-GPR17 transfection was due to downregulation of GPR17 expression. Furthermore, co-electroporation of GPR161, another negative regulator of the Shh signalling pathway [24], did not abolish the phenotypes caused by si-GPR17, confirming the specificity of si-GPR17 (more than 6 embryos for each; S4G-S4I” Fig). The expansion of ventral identity was also observed when sh-GPR17, another knockdown DNA-based construct, was electroporated into neural tubes (more than eight embryos for each; S5 Fig), confirming the observations made with si-GPR17. Thus, GPR17 was demonstrated to be a negative regulator of the intracellular Shh signalling, and is essential for proper pattern formation in the neural tube.
GPR17 is essential for dynamic control of Shh activity
Given that expression of GPR17 is induced by Shh, and GPR17 negatively regulates the Shh signal activity at the intracellular level (Fig 1B, 1D, 2E, 3E-3L), we reasoned that GPR17 is involved in temporal regulation of Gli activity [13-15]. To test this hypothesis, we analysed the role of GPR17 in temporal regulation of the Gli activity.
First, to confirm that the intracellular Shh signal activity was aberrantly upregulated, we prepared intermediate neural explants electroporated with si-GPR17, and then treated them with ShhL. Although Olig2-expressing cells were predominant in the si-control electroporated explants (5 areas; Fig 5A, 5B, 5E, 5F, 5I), a significantly higher population of Nkx2.2-positive cells appeared at 24 hours in the si-GPR17 electroporated explants (5 areas; Fig 5C, 5D, 5G, 5H, 5I), suggesting that the intracellular Shh signal activity was upregulated when GPR17 expression was reduced. This observation was supported by the effect of treatment with pranlukast, a chemical antagonist of GPR17 [35,40]; explants treated with 10 μM pranlukast in combination with ShhL tended to contain larger proportions of Nkx2.2-positive cells than controls, suggesting that perturbation of GPR17 caused the more ventral identity (10 areas each; S6A-S6G Fig).
We next sought to analyse dynamic control of the intracellular Shh signal activity during ventral neural differentiation. For this purpose, we performed luciferase reporter assays using GBSLuc at various time points. We prepared explants electroporated with GBS-Luc with either si-control or si-GPR17, and then measured Gli activity at a series of time points from 6 to 48 hours after the initiation of the culture. In si-control-electroporated explants treated with ShhL, Shh activity gradually decreased over time, peaking at 6 hours and becoming undetectable by the 48 hour time point (more than 3 explants per point; Fig 5J, blue line), consistent with previous reports [13,14]. On the other hand, in explants with si-GPR17, Gli activity at 6 hours was comparable to that of the si-control explants, but the activity was significantly higher at 24 hours and still detectable at 36 hours (Fig 5J, red line).
We next attempted to confirm that the dynamic Gli activity reflects the gene expression. As the Ptch1 and Gli1 genes are direct targets of the Shh signal, their expression levels correspond to the Gli activity [17]. We therefore cultured the explants electroporated with si-control or si-GPR17 in the presence of ShhL for different time periods, and measured the expression levels of Ptch1 and Gli1 by RT-qPCR. As the result, the expression peaked at 12 hours and then decreased quickly at 24 hours in si-control electroporated explants (Fig 5K and S6H Fig, blue lines). However, in the si-GPR17-electroporated explants, while the expression peak at 12 hours was comparable, the decrease was delayed, and the expression level was significantly higher at 24 hours (Fig 5K and S6H Fig, red lines). This result supports the idea that the dynamic Gli activity was affected, at least partially, by the perturbation of the GPR17 expression.
In addition, we calculated the ratio of Gli3FL and Gli3R in the neural tube. For this purpose, we prepared isolated neural tubes that had been electroporated with either si-control or si-GPR17, and analysed the forms of Gli3 by western blotting. We found that the ratio of Gli3FL over Gli3R was significantly higher in si-GPR17-electroporated neural tube than in the control (4 experiments; Fig 5L and 5M) [18].
Together, these findings indicate that GPR17 is an essential upstream factor that controls the dynamic change between the full-length and repressor forms of Gli3, and thus regulates the temporal change in the intracellular Shh signalling activity.
GPR17 affects cell fate determination in neural differentiation from mouse ES cells
We finally assessed whether GPR17 functions are conserved in different organisms by investigating its expression and functions in aspects of mouse development.
We first analysed the expression pattern of GPR17 in the mouse spinal cord. At embryonic day 10.5 (e10.5) when neural tube pattern formation is taking place, expression was evident in the ventral region (S7A Fig) with the highest expression in the Olig2-positive cells (S7A, S7a’, S7a” Fig), with marginal expression in the dorsal area (S7A Fig). At e11.5, the expression was more ventrally restricted to the Nkx2.2-positive region (S7B, S7b’, S7b” Fig), with the neuronal expression (S7B Fig). This expression pattern was almost the same as in the developing spinal cord of chicks, regardless of some species-specific expression.
Next we investigated the requirement of GPR17 in the neural fate determination. For this analysis, we examined the directed neural differentiation of the embryonic stem (ES) cells, because the effect of treatments on gene expression are easily evaluated in this system. Mouse ES cells were differentiated into neural subtypes of pMN, p3 and floor plate using different combinations of retinoic acid (RA) and SAG, as described previously (S8A Fig) [41].
First, we evaluated GPR17 expression by RT-qPCR in each neural subtype. The results revealed significantly higher GPR17 expression in pMN and p3 cells than in FP 5 days after the start of differentiation (day 5) (3 experiments; Fig 6A), suggesting that expression can be recapitulated in neural cells differentiated from ES cells.
Next, we sought to analyse the function of GPR17 in neural differentiation and subtype determination, and transfected two different si-RNAs (si-GPR17-1 and si-GPR17-2) targeting GPR17 in ES cells. The efficient knockdown of GPR17 expression was validated by RT-qPCR (3 experiments; S8B Fig).
Under these conditions, ES cells were differentiated into pMN cells (S8A Fig), and gene expression was evaluated on day 5. In the pMN condition, the majority of cells expressed Olig2, with a small subset of Nkx2.2-positive cells, as demonstrated by immunohistochemistry (3 experiments; Fig 6B, 6E, 6H, 6K). By contrast, treatment with si-GPR17 increased the Nkx2.2-expressing cells (Fig 6E-6K). This observation suggests that si-GPR17-treated cells became more susceptible to the Shh ligand and tended to differentiate into the more ventral identity of p3 (S8C-S8E Fig), for which a higher Gli activity was required [41].
We next verified this tendency by RT-qPCR. In cells treated with si-GPR17s, the Nkx2.2 expression was higher than in si-control-transfected cells at day 5, confirming the results obtained by the immunohistochemistry (3 experiments; Fig 6L). Furthermore, the expression level of Ptch1, a target gene of the Shh signal, was higher in si-GPR17 cells than in the controls (3 experiments; Fig 6L). These results were consistent with the findings obtained in the analyses of chick embryos.
These findings suggest that mouse GPR17 is expressed in the pMN and p3 cells differentiated from ES cells as in the chick embryos, and functions as a modulator for the ventral identities of the neural cells.
Discussion
GPR17 is a negative regulator of the Shh signalling pathway and affects ventral pattern formation of the neural tube
In this study, we isolated one of the GPCRs GPR17, and characterised its role in neural development. Although its expression is induced by Shh, GPR17 negatively regulates the Shh signal, thereby affecting the dynamicity of the Gli activity [13,14]. Negative regulation of the intracellular Shh signal by GPR17 is conserved in the mouse, as demonstrated by a system involving neural differentiation of ES cells (Fig 6).
GPR17 was initially recognised as one of the genes that respond to neural tube injury, brain damage or pathological situations [42-44]. To reveal the essential roles of GPR17 in the body, GPR17-knockout mice were generated. The analysis consequently elucidated that GPR17 is a molecular timer for oligodendrocyte differentiation [44]; the deficiency of GPR17-gene caused the earlier differentiation and excessive production of oligodendrocyte cells [27]. Subsequently, the function in the oligodendrocyte development and the demyelination and remyelination have been emphasised. GPR17 expression is gradually upregulated during the demyelination induced by the glial toxin Lysolecithin [45]. Conversely, the antagonist supporting GPR17 increases the oligodendrocyte cell number [46]. Moreover, the proliferation of the Olig2-expressing cells is encouraged in the situation where GPR17 is attenuated [45]. Given that oligodendrocyte differentiation is supported by Shh [47], the phenotypes caused by the blockade of GPR17 expression or functions could be due to hyper-activation of Gli activity. Therefore, the notion we propose here - GPR17 is a negative regulator for Shh signalling pathway, especially for the Gli activity - is consistent with the previous findings obtained using this GPR17-deficient mouse [27].
Although GPR17 has been suggested to be a receptor for the uracil nucleotides and Cysteinyl leukotrienes (cysLTs) [42,48], the actual ligand(s) for GPR17 working in the developmental contexts have not been identified. In this study, while we did not find an explicit effect of the overexpression of GPR17 in vivo (S4A-S4C” Fig), it is still possible that GPR17 may be activated by the endogenous ligands and that the identification of such ligands is one of the important questions to be addressed in the future.
In this study, we utilised MDL29951 to experimentally activate GPR17 (Fig 3F, 3H, 3J, 3K-3M, S3E-S3E”, S3J-S3J” Fig). While MDL29951 has been recognised as an agonist of GPR17 [35] and was actually used to analyse the function of GPR17 [28], MDL29951 has also been recognised as an antagonist of the N-methyl-D-aspartate (NMDA) receptor [49,50]. However, as we demonstrated, MDL29951 synergistically acted with GPR17 (S3 Fig) and it is highly likely that MDL29951 works in concert with GPR17 to determine the pattern formation and fate determination of the developing neural cells.
In the chick embryos, our in situ hybridisation analysis detected the expression of GPR17 at the earlier stages than the onset of gliogenesis, which contributed to neural tube pattern formation (Fig 1A, 1B, 1D). Also in the mouse embryos, the immunohistochemistry analysis revealed the GPR17 expression at e10.5 at the ventral region of the spinal cord (S7A Fig). By contrast, in a previous report [27], GPR17 expression is firstly recognised at e14.5 in the mouse brain using reporter gene expression. The difference between our data and the previous findings is presumably caused by the protein stability of GPR17 or the difference in the detection methods.
While our analysis revealed the essential roles of GPR17 on the dorsal-ventral pattern formation of the spinal cord in chick, the effect in the mouse neural tube has been unknown, and at least, does not seem to be critical [27,45,46], as GPR17-deficient mice are viable. This is probably due to the redundant roles of the multiple GPCRs expressed in the neural tube. The expression of Adenylyl cyclase 5 (AC5), which catalases the dissociation of ATP to make cAMP [20,21], was found to be induced by Shh both in chick and mouse neural explants (S9 Fig). Thus, it is possible that GPR17 and AC5 have redundant roles in the neural tube development, and that the dependency on multiple GPCRs may differ among different species; the chick neural tube mainly depends on GPR17 in the pattern formation while the mice depend also on the other genes.
GPCRs can bind to different types of Gα proteins, including Gαi, Gαs, Gαq and Gα12,13 [23]. Among these Gα proteins, Gαq and Gαs can increase the intracellular cAMP level, whereas Gαi proteins mostly exert an inhibitory effect, and GPR17 can bind all types of G-proteins [35]. During the remyelination, GPR17 binds to Gαi and decreases the cAMP level [28,36,51,52]. By contrast, in our experiments GPR17 rather upregulated the cAMP level, presumably by binding to Gαq and/or Gαs, suggesting that it has diverse and cell type-specific functions.
Concerning the relationships between GPCR and Shh signal, two GPCRs, GPR161 and GPR175, have been well characterised [22,24,25]. GPR161 is an orphan receptor that increases the intracellular cAMP level and has a negative effect on the ventral neural pattern formation. Within the cell, GPR161 is localised at the ciliary shaft and is involved in local calcium uptake when Shh protein arrives at the cilia [21,24]. GPR175, which localises to non-ciliary cell membrane, is translocated to the cilia when cells are exposed to Shh [25]. By contrast, GPR17 is localised throughout in the cells (Fig 2B), and its localisation is not affected by Shh signals (Fig 2B-2D’), suggesting that the roles of GPR17 are distinct from those of these other GPCRs. At the tissue level, expression of GPR161 is ubiquitous and that of GPR175 is unknown, whereas GPR17 expression is explicitly upregulated by Shh. The relationship among multiple GPCRs in regulation of the intracellular Shh signal is an intriguing issue to be addressed in the future.
GPR17 constitutes a negative feedback loop of the Shh signalling system
A historical model suggested that a morphogen can produce a number of cell types depending on the thresholds of the signal concentration [53]. This hypothesis relies on the supposition that signal concentration corresponds completely to the intracellular signal intensity. However, recent studies suggest that the temporal change in signal activity, so-called temporal adaptation, is important for cell fate determination and correct pattern formation [1,13,14]. The results of this study reveal a novel negative feedback loop constructed by a GPCR through regulation of the intracellular cAMP level and processing of Gli transcription factors. Recent mathematical modelling suggests the existence of negative regulators induced by Shh [17], and our findings regarding GPR17 are in good agreement with this hypothesis.
Although Shh induces the GPR17 expression (Fig 1D), GPR17 does not seem to be a direct target gene of Gli transcription factors, as GBS has not been identified in the flanking regions of the GPR17 locus [41]. Instead, Olig2 is the direct regulator of GPR17 expression [28]. Consistent with this finding, overexpression of Olig2 in neural explants induces GPR17 expression (Fig 1E). This could explain why the negative feedback regulation is cell type-specific and does not take place in the NIH3T3 cells treated with the Shh ligand [17]; Olig2 expression is induced only in the neural progenitor cells, but not in NIH3T3 cells (AY, AH, NS; unpublished observation).
While it was shown that Olig2 directly induces the GPR17 expression [28], Olig2, together with its related factor Olig1 [54], has been shown to be a transcriptional repressor [55], and the activator type of Olig2 (Olig2DBD-VP16) [54] works as an antimorphic mutant to repress the GPR17 expression (S10 Fig). This apparent discrepancy could be explained by the existence of cofactor(s) or other transcription factor(s), whose expression depends on Olig2. Moreover, it is possible that the other factors are involved in the GPR17 expression [56], as the GPR17 expression is evident in the domains where Olig2 is not expressed (Fig 1B), and the overexpression of Olig2DBD-VP16 only partially block the GPR17 expression (S10B Fig).
In a developmental context, negative feedback regulation confers diversity of cell types and robustness of pattern formation [14]. To date, multiple negative feedback systems for the Gli activity have been identified [17]. For instance, the Ptch1 gene, whose product negatively regulates the intracellular Shh signal activity, is a direct target of Shh (Fig 7) [13]. Moreover, expression of the transcriptional mediator Gli2 decreases over time during neural development, although the underlying regulatory mechanisms remain elusive [17]. In combination with the existence of GPR17 as this study demonstrated (Fig 7), multiple negative feedback systems could cause differences in the half-life of the signal in each progenitor cell, allowing diverse cell types to be produced by a single morphogen, Shh. Moreover, during formation of the morphogen gradient, uncertainties and fluctuations may arise. This noise in the signal is constantly modulated by negative feedback, and consequently the reliability and reproducibility of pattern formation can be incarnated [57,58]. Therefore, the negative feedback loop formed by Shh and GPR17 is important not only for overall neural tube pattern formation, but also for fine tuning of signal intensity, and consequently establishes the quantitative balance among different cell types during neural and neuronal differentiation. Further studies, including analysis of the temporal change of intracellular cAMP level, will reveal the significance of GPR17 in negative feedback of the Shh signal.
Materials and Methods
Isolation of GPR17
GPCRs that can couple with Gαq or Gαs were identified by referring to the website (http://gpcrdb.org), and qPCR primers were designed against the corresponding genes (S1 Table). Relative expression levels were analysed by RT-qPCR in neural explants treated or untreated with ShhH (S1 Fig). NCBI Gene IDs for chicken and mouse GPR17 are 769024 and 574402, respectively.
Embryos, electroporation and expression analysis
All animal experiments were performed with the approval of the Animal Welfare and Ethical Review Panel of Nara Institute of Science and Technology (approval numbers 1636 and 1810 for chicken and mouse experiments, respectively). Chicken eggs were purchased from the Shiroyama Keien farm (Kanagawa prefecture, Japan) and the Yamagishi farm (Wakayama prefecture, Japan), and the developmental stages were evaluated by the Hamburger and Hamilton’s criteria [59]. In ovo electroporation of chick embryos was carried out with an ECM830 electroporator (BTX), and embryos were incubated at 38°C for the indicated times. Overexpression in the chick embryos was performed with the constructs subcloned into the pCIG expression plasmid, which contains an IRES (internal ribosomal entry site) -GFP gene downstream of the gene of interest [60]. pCIG-Olig2DBD-VP16 was constructed by fusing the DNA-binding region of Olig2 with the transactivation domain of the viral protein VP16, as described previously [55]. Embryos were fixed with 4% paraformaldehyde, subsequently incubated with 15% sucrose for cryoprotection and embedded in 7.5% gelatine (Sigma). Cryosections were cut at 14 μm increments and analysed with immunohistochemistry or in situ hybridisation. The sections from at least five independent embryos were analysed, and the number of the embryos analysed were indicated in the text. For loss-of-function experiments, si-GPR17 (GGAACAGAGUGGAGAAACACCUG(dA)(dA) (sense) and UUCAGGUGUUUCUCCACUCUGUUCCCA (antisense)) or si-Luciferase (ACUGAGACUACAUCAGCUAUUCU(dG)(dA) (sense) and UCAGAAUAGCUGAUGUAGUCUCAGUGA (antisense), as a negative control; Eurofin) was electroporated with the pCIG vector, which encodes GFP as a tracer. For gene silencing with short-hairpin constructs, AAGAGACACACCTCGAGAATG (chicken GPR17) or AATGTATTGGCCTGTATTAGC (control) was subcloned into the pRFP-RNAiC vector [61].
DIG-labelled (Roche) complementary RNA probe was synthesised using RNA polymerase (Promega). In situ hybridisation on slides was performed as described previously [62]. For western blotting, neural tube tissues electroporated with siRNAs were manually isolated from embryos and dissociated in TN Buffer (150 mM NaCl, 5 mM KCl, 0.5% NP-40 detergent, 10 mM Tris-HCl, pH 7.8) with protease inhibitor cocktail (Roche).
Immunohistochemistry was performed as described previously [62]. Primary antibodies against the following proteins were used in this study: Olig2 (rabbit, Millipore AB9610), Nkx2.2 (mouse, DSHB 74.5A5; rabbit, Abcam ab19077), Islet1/2 (DSHB 39.4D5), Pax7 (DSHB), FoxA2 (goat, Santa Cruz sc-6554X), Sox2 (rabbit, Millipore AB5603), GPR17 (goat, Abcam ab106781 for mouse embryos; rabbit, Sigma SAB4501250 for cells), GFP (sheep, AbD Serotec 4745-1051), Gli3 (goat, R&D AF3690), β-Actin (rabbit, Abcam ab8227), and γ-acetylated tubulin (mouse, Sigma T7451). In the western blots with this Gli3 antibody, we always found two unexpected bands located at approximately 160 and 110 kDa, whose intensities accompanied that of Gli3, even though these bands were not Gli3. For GPR17 immunochemistry in mouse embryonic sections, antigenic retrieval was required; slides were boiled for 1 minute in 10 mM of citric acid (pH 6.0) solution prior to the incubation with the primary antibody. Fluorophore- and HRP-conjugated secondary antibodies were purchased from Jackson Laboratory and Cell Signaling Technology, respectively.
New culture and intermediate neural explants
New culture was performed as described previously [37]. Culture plates containing albumen and agarose were prepared with the final concentration of 100 μM of MDL29951 or with dimethylsulfoxide (DMSO) (control). Chick embryos were taken from the eggs at HH stage 12 with a ring of filter paper, and put on the culture plates with the ventral side up. Embryos were cultured in the 38°C incubator for 36 hours, and the plates were kept humid with Hanks’ Balanced Salt solution (1xHBSS; Sigma-Aldrich).
Chick intermediate neural explants were prepared as described previously [62]. Briefly, HH stage 9 embryos were isolated from the eggs and maintained in L-15 medium (Thermo Fisher Scientific). After treated with dispase II (Sigma), the intermediate region of the neural plate at the preneural tube level [26] were manually excised from the embryos and cultured in DMEM/F-12 medium (Thermo Fisher Scientific) supplemented with Mito+Serum Extender (Sigma) and Penicillin/Streptomycin/Glutamine (Wako). Quantitation of positive cells was performed on at least five areas, each of which contained approximately 200-250 cells, randomly chosen from independent explants. For RT-qPCR analyses, RNA was extracted from the pools of 15 chick intermediate neural explants by using PicoPure RNA extraction kit (Thermo Fisher Scientific). Each extraction gave a range of 500 ng (12-hour culture) to 1.5 μg (48-hour culture) of total RNA, as measured by Nanodrop (Thermo Fisher Scientific). Complementary DNAs (cDNAs) were synthesised by PrimeTaq reverse transcriptase (TaKaRa), and qPCR was performed by using LightCycler 96 (Roche). At least two independent pools of explants were analysed in each experiment, and each gene expression level was normalised with the GAPDH expression.
Mouse neural explants (S9 Fig) were prepared from the e8.5 embryos and were cultured in the same way as in the chick explants [15], except that the culture medium contained N2 and B27 supplements (Thermo Fischer Scientific).
Cell culture, transfection and selection
NIH3T3 fibroblast cells were maintained in Dulbecco’s modified Eagle’s medium /F12 medium (Wako) containing 10% New-Born Calf Serum (MP Biomedicals). Lipofectamine 3000 (Invitrogen) was used for transfection. To obtain explicit evidence of the effects on the overexpression of the genes in Fig 2E-2I, the transfected cells were selected for 48 hours with 500 μg/ml of G418 (Invitrogen) from one day after the pcDNA3-based expression plasmids were transfected, and were used for assays.
Monitoring the Gli activity and the intracellular cAMP levels
The GBS-Nano-Luc reporter construct containing the GBS was constructed by subcloning of the octameric GBS [63] to the pNL3.2 vector (Promega), and used to monitor Gli activity. pCS2-firefly luciferase was used for an internal control. For the luciferase assays on chick neural explants in Fig 3L and Fig 5J, GBS-Nano-Luc and pCS2-fiefly-luciferase were electroporated at the preneural tube region of the caudal part of the chick embryos at HH stage 9- [26]. si-RNAs were co-electroporated if necessary. The explants were then prepared and were cultured with the indicated conditions. The relative luciferase activities were compared to those cultured without Shh at every time point. 7-8 explants were grouped for each measurement, and four to 10 groups of explants were measured in one condition.
CREB-Luc (luciferase gene driven by the cAMP-responsive element-binding region) was a kind gift from Prof. Itoh [64] and pRL-CMV (Promega) was used for an internal control. The measurement of the chemiluminescence was performed by using the plate reader Tristar2 (Berthold Technologies).
For the cAMP assay in the NIH3T3 cells (Fig 2H), the cells were transfected with the indicated plasmids and the transfected cells were selected for 24 hours. 3-isobutyl-1-methylxanthine (IBMX) was added at 1 μM in the last 30 minutes before cells were harvested. For the cAMP assay in the neural explants (Fig 3I), 15 explants were prepared for each condition and cultured for 24 hours. IBMX was added in the last 1 hour. The cAMP assay was performed using DetectX high sensitivity direct cAMP Chemiluminescent Immunoassay Kit (Arbor Assays). The protein concentrations of the cell lysates were measured by CBB protein assay solution (Nacalai, Japan) and the measurement values were normalised.
TUNEL assay
TUNEL assay was performed to detect the apoptotic cells. The neural tube sections or the explants were incubated with TdT transferase (Roche) and DIG-labelled dUTP (Merck Millipore), and the signals were visualised by anti-Digoxigenin-Rhodamine antibody (Sigma). Staurosporine [65] was used as a positive control at 1nM.
Neural differentiation of mouse ES cells
The Sox1-GFP ES cell line was kindly provided by Prof. Smith, and maintenance and neural differentiation as a monolayer culture were performed as described previously [41,66,67]. Briefly, on the fibronectin/collagen-coated plates, approximately 1.5 × 104 ES cells were seeded and cultured as monolayers in the differentiation medium [41] for the initial 3 days. For pMN differentiation, cells were added with 300 nM RA (Sigma) on day 3.0 and 50 nM SAG was added on day 3.5; and the cells were incubated for totally 5 days. For p3 differentiation, 30 nM RA and 500 nM SAG (Sigma) were added on day 3.0 and day 3.5, respectively. For FP differentiation, 500 nM SAG was added on day 3.0. Before differentiation was initiated, Stealth siRNAs (Invitrogen) (si-GPR17-1, UCGCCUGCUUCUACCUUCUGGACUU; si-GPR17-2, ACCGUUCAGUCUAUGUGCUUCACUA) or si-control (Invitrogen) were transfected twice at 24 hour intervals using Lipofectamine RNAiMAX (Invitrogen). For RT-qPCR analysis, RNA was extracted by RNeasy RNA extraction kit (QIAGEN). cDNA synthesis and qPCR were performed as in the chick neural explants.
Images and data analysis
Images were collected by using AxioVision2 (for in situ hybridisation images; Zeiss), LSM 710 confocal microscope (for immunohistochemistry data; Zeiss), LAS4000 (for western blots; GE Healthcare), and signal intensities of the western blots were calculated by ImageJ. Images were processed by the software Photoshop (Adobe) and figures were arranged on Illustrator (Adobe). Statistical analysis was performed with Prism (GraphPad) by two-tailed t-test. Statistical data are presented as mean values ± s.e.m., and significance (*; p<0.05; **; p<0.01, ***; p<0.001, ****; p<0.0001) were indicated in each graph.
Data Availability
All relevant data are within the text, figures, and their Supporting Information files.
Funding
This study was supported in part by grants-in-aid from MEXT (15H06411, 17H03684; NS); the Joint Research Program of the Institute for Genetic Medicine, Hokkaido University (TK, NS); the Takeda Science Foundation (NS); the Mochida Memorial Foundation for Medical and Pharmaceutical Research (NS); the Ichiro Kanehara Foundation for the Promotion of Medical Sciences and Medical Care (NS); the Uehara Memorial Foundation (NS); and the NOVARTIS Foundation (Japan) for the Promotion of Science (NS). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests
The authors have declared that no competing interests exist.
Author Contributions
Conceived the project: NS. Performed the experiments, analysed the data: AY, AH, MK, NS. Providing essential materials and advice: MMT, TK. Writing the manuscript: NS.
Acknowledgements
The authors are grateful to Profs. Austin Smith and Hiroshi Itoh for materials, Dr. James Briscoe for comments on the manuscript, Dr. Yuichi Sakumura for advice, Prof. Takashi Toda for encouragement, and all laboratory members for support and valuable discussion.