ABSTRACT
Cerebrospinal fluid flow is crucial for neurodevelopment and homeostasis of the ventricular system of the brain, with localized flow being established by the polarized beating of the ependymal cell (EC) cilia. Here, we report a homozygous one base-pair deletion, c.1193delT (p.Leu398Glnfs*2), in the Kinesin Family Member 6 (KIF6) gene in a child displaying neurocranial defects and intellectual disability. To test the pathogenicity of this novel human KIF6 mutation we engineered an analogous C-terminal truncating mutation in mouse. These mutant mice display severe, postnatal-onset hydrocephalus. We generated a Kif6-LacZ transgenic mouse strain and report expression specifically and uniquely within the ependymal cell (EC) layer of the brain, without labeling other multiciliated mouse tissues. Analysis of Kif6 mutant mice with scanning electron microscopy (SEM) and immunofluorescence (IF) revealed a reduction in EC cilia, without effect on other multiciliated tissues. Consistent with our findings in mice, defects of the ventricular system and EC cilia were observed in kif6 mutant zebrafish. Overall, this work describes the first clinically-defined KIF6 homozygous null mutation in human and defines KIF6 as a conserved mediator of neuro-cranial morphogenesis with a specific role in the maintenance of EC cilia in vertebrates.
AUTHOR SUMMARY Cerebrospinal fluid flow is crucial for neurodevelopment and homeostasis of the ventricular system of the brain. Localized flows of cerebrospinal fluid throughout the ventricular system of the brain are established from the polarized beating of the ependymal cell (EC) cilia. Here, we identified a homozygous truncating mutation in KIF6 in a child displaying neuro-cranial defects and intellectual disability. To test the function of KIF6 in vivo, we engineered mutations of Kif6 in mouse. These Kif6 mutant mice display severe hydrocephalus, coupled with a loss of EC cilia. Similarly, we observed hydrocephalus and a reduction in EC cilia in kif6 mutant zebrafish. Overall, this work describes the first clinically-defined KIF6 mutation in human, while our animal studies demonstrate the pathogenicity of mutations in KIF6 and establish KIF6 as a conserved mediator of neuro-cranial development and EC cilia maintenance in vertebrates.
INTRODUCTION
The delicate balance of cerebrospinal fluid (CSF) production and flow is important for the morphogenesis and function of the brain development and homeostasis. CSF circulation in human is largely due to gradients established by the secretion of CSF from the choroid plexuses, and its resorption at the arachnoid granulations [1]. The clinical significance of CSF stasis includes hydrocephalus and intracranial hypertension. Moreover, severely diminished CSF flow combined with increased intracranial pressure can secondarily cause ventriculomegaly, cognitive impairment, as well as degenerative and age-related dementias [2]. For these reasons, the identification of genetic risk factors involved in the pathogenesis of CSF stasis is critical for the development of genetic diagnostics and early interventions for these disorders.
One element for circulation of CSF is the multiciliated ependymal cells (ECs), which are specialized glial cells covering the ventricular walls of the brain and spinal canal [3]. In contrast, to primary cilia which are single, immotile cellular organelles extending from most cell types, ECs contain dozens of apically-arranged motile cilia, which beat in a polarized fashion to generate localized or near-wall CSF flows [4]. Defective EC cilia or loss of their polarized beating causes a disruption of this localized CSF flow leading to increased intracranial pressure, and dilation of ventricles and hydrocephalus in mice [5–8]. Importantly, this EC cilia-driven CSF flow is crucial for regulating brain function and adult neurogenesis [4, 9].
Impaired ciliary motility due to disruptions of the key kinesins, dyenins, and intraflagellar components necessary in most or all cilia, results in a syndromic condition known as primary ciliary dyskinesia (PCD) in humans [10, 11]. While hydrocephalus can occur in some PCD patients, it is a less common manifestation of the disease in humans [11]. In contrast, genes implicated in PCD or mutations which disrupt the structure or motility of all motile cilia are strongly correlated with hydrocephalus in mouse [8]. Alternatively, some hydrocephalus in mice with dysfunctional cilia may be the result of altered function of the choroid plexus, prior to the onset of cilia-driven CSF flow [7].
KIF6 (Kinesin family member 6, MIM: 613919) encodes a member of the kinesin-9 superfamily of microtubules motor proteins which act predominately as “plus-end” directed molecular motors that generate force and movement across microtubules [12]. Kinesins are critical for numerous cellular functions such as intracellular transport and cell division, as well as for building and maintaining the cilium in a process known as intraflagellar transport [13]. During this process, kinesins have been shown to transport cargo within the ciliary axoneme [14], establish motility and compartmentalization of the axoneme [15], or to facilitate plus-end directed microtubule disassembly and control of axonemal length [16]. As such, multiple kinesins have shown to be associated with monogenic disorders affecting a wide-spectrum of tissues, with several modes of inheritance (www.omim.org). Interestingly, KIF6 has previously been proposed as locus for susceptibility to coronary heart disease [17], while other studies did not substantiate this association [18]. We previously reported that kif6 mutant zebrafish are adult viable exhibiting larval-onset scoliosis without obvious heart defects [19]. Because of these conflicting results, and a lack of relevant mouse models, the role of KIF6 in human disease remains an open question.
Here, we present a patient with consanguineous parents, presenting with neuro-cranial defects and intellectual disability. Homozygosity mapping followed by whole-exome sequencing (WES) identified a novel homozygous frameshift mutation in KIF6 which is predicted to result in the truncation of the C-terminal cargo-binding domain of the kinesin motor protein. We generated an analogous frameshift mutation in the mouse and found that these mutant mice displayed progressive, postnatal-onset hydrocephalus with cranial expansion, coupled with a reduction in the quantity of EC cilia. In addition, we observed that kif6 mutant zebrafish also display dilation of the ventricular system, coupled with reduced EC cilia. Interestingly, we failed to observe additional PCD related defects of other multiciliated tissues in Kif6 mutant mouse or zebrafish models. Together these results demonstrate that KIF6 function is unique and specific for EC cilia. Finally, we propose that KIF6 represents a novel gene for neuro-cranial development and intellectual disability in humans.
RESULTS
Clinical features and mutation identification
We identified a Thai boy with intellectual disability and megalencephaly. His parents were first cousins. He was born at 34 weeks gestation with a head circumference of 34 cm (97th centile). APGAR scores were 7 and 9 at 1 and 5 minutes, respectively. Neonatal hypoglycemia (blood sugar of 11 mg/dL) and neonatal jaundice were treated promptly. In the first few months of life, he was found to have delayed neurodevelopment and central hypotonia. He was able to hold his head at 5 months, rolled over at 8 months, walked and had first words at 2 years old. At the age of 9 years and 9 months, an IQ test by Wechsler Intelligence Scale for Children: 4th edition (WISC-IV) revealed that his full-scale IQ was 56, indicating intellectual disability. The patient had possible seizure activity at age 10 described as parasomnias, was found to have intermittent bifrontocentreal rhythmic theta activity, and the spells resolved after valproic acid therapy. His height and weight followed the curve of 50th centile, but his head circumference remained at 97th centile (53.5 cm and 55 cm at 6 and 9 years old, respectively). Physical examination was generally unremarkable except macrocephaly and low-set prominent anti-helical pinnae (Fig 1A). Eye examination, hearing tests, thyroid function tests, chromosomal analysis, and nerve conduction velocity were normal. Both brain CT scans at 4 months and 8 years old and brain MRI at 7 months old showed a slight dolichocephalic cranial shape (cephalic index = 75), without overt structural brain abnormalities (Fig 1B-D). X-ray analysis of the spine showed no obvious scoliosis at 10-years-old (Fig 1E).
To elucidate the genetic etiology, we performed homozygosity mapping, whole genome array comparative genomic hybridization (CGH), and whole exome sequencing (WES). WES identified 83 homozygous variants, which had not been reported as SNPs in dbSNP137 (S1 Table). We then selected only those located within the 63 homozygous regions found by homozygosity mapping (S2 Table). Seven candidate variants (one frameshift and six missense mutations; Table I) were identified. Of the six missense, five were predicted to be either benign by Polyphen-2 or tolerated by SIFT prediction programs. The remaining variant, c.235G>A; p.V79M of the Carboxypeptidase E (CPE) gene, was not evolutionarily conserved among diverged species (S1 Fig). We, therefore, decided to further our study on the only candidate truncating mutation, a homozygous one base-pair deletion, c.1193delT (p.Leu398Glnfs*2) in exon 11 of Kinesin family member 6 (KIF6) (NM_001289021.2).
KIF6 is located on human chromosome 6p21.2 and comprises 23 exons. The 2.4-kb KIF6 cDNA encodes a canonical N-terminal kinesin motor domain (amino acid positions 3-353) and three coiled-coil regions (amino acid positions 358-385, 457-493, and 633-683), predicted by SMART server [20]. Segregation of the homozygous sequence variant with the disease phenotype was confirmed by Sanger sequencing (Fig 1F) and by restriction fragment length polymorphism (RFLP) analysis of the pedigree (Fig 1G), while his parents and his unaffected brother were heterozygous for the deletion (Fig 1F, G and data not shown). The deletion was not observed in our 1,600 in-house Thai exomes, the 1000 Genome Database, and the ExAC Database. The pedigree combined with the novelty of the mutation in KIF6 presented here, strongly suggest this C-terminal truncating mutation in KIF6 may be etiologic for neuro-cranial developmental defects.
Generation of Kif6 Mutation in Mouse
To test the functional consequence of the C-terminal truncating p.L398fsX2 mutation (Fig 1H), we generated an analogous frameshift mutation in exon14 of the mouse Kif6 (ENSMUST00000162854) gene, which is ~150bp downstream of the frameshift mutation found in the patient (Fig 2A). After backcross of founder mice to C57B6/J strain, we identified a nonsense allele with scarless insertion (c.1665ins) of a 3-stop donor cassette-providing integration of an ochre termination codon in all three reading frames into the endogenous Kif6 locus (S2 Fig). This endonuclease-mediated insertional frameshift mutation (Kif6em1Rgray) is predicted to truncate the C-terminal cargo-binding domain of the kinesin motor protein (p.G555+6fs). This novel mutant allele of Kif6 (hereafter called Kif6p.G555fs) is predicted to encode a C-terminal truncated KIF6 protein 168 amino acids longer than is predicted for the human p.L398fsX2 variant (Fig 2A).
Hydrocephalus in Kif6p.G555fs Mouse
Intercrossing Kif6p.G5555s/+ heterozygous animals gave offspring with the expected Mendelian ratios, with typical appearance at birth. However, beginning at postnatal day (P)14-onwards, 100% (n=7) of Kif6p.G555fs/p.G555fs homozygous mutant mice displayed classic indications of hydrocephalus including doming of the cranium (Fig 2C), a hunched appearance, and with decreased open field activity. We observed apparent megalencephaly and hemorrhaging in older (P21-P28) Kif6p.G555fs/p.G555fs mutant brains (Fig 2D), which likely results from increased intracranial pressure and swelling of the ventricles causing damage to the neural tissue against the cranium. At P14, the body weights were not significantly decreased in Kif6p.G555fs mutants (5.8±1.3 (g)rams) compared with littermate controls (7.0±1.2g) (n=5/genotype; p=0.17). However, at P28 mutant mice showed decreased weight on average (12.67±1.53 g) compared to littermate controls (15.33±1.15g), although this trend was not statistically significant (n=3/genotype; p= 0.07). At P28, extracted whole brain sizes appear to be larger in Kif6p.G555fs/p.G555fs mutants compared to non-mutant littermate controls (Fig 2D). For these reasons, mutant animals were not maintained for observation past P28. qPT-PCR analysis of several Kif6 exon-exon boundaries found no evidence for non-sense mediated decay in Kif6p.G555fs mutant mice (Fig 2B).
To determine whether a more N-terminal truncated Kif6 mutation would result in a more severe hydrocephalus phenotype, we isolated a conditional-ready Kif6 allele, where exon 4 is flanked by LoxP sites (Kif6tm1c) (KOMP repository, see Methods and Materials). Recombination of the Kif6tm1c allele is predicted to generate a frameshift mutation, which should generate a severely truncated, 89 amino acid, KIF6 protein (p.G83E+6fs) with a non-functional N-terminal motor domain. We generated a whole body conditional knockout by crossing the Kif6tm1c mouse to the CMV-Cre deleter mouse [21]. We observed postnatal-onset, hydrocephalus in CMV-Cre; Kif6tm1c/tm1c conditional mutant mice (n=10) analogous to our observations in Kif6p.G555fs/p.G555fs mutant mice (data not shown). Interestingly, we find no evidence of non-sense mediated decay in these mutant mice despite the generation of an early premature termination codon (data not shown). Because the onset and progression of hydrocephalus was equivalent comparing the whole-body conditional CMV-Cre; Kif6tm1c/tm1c and Kif6p.G555fs/p.G555fs mutant mice strains we suggest that any KIF6 protein encoded by these mutant mouse strains is likely non-functional. Given its relevance to the human mutation, the majority of experiments were all done using the p.G555fs allele.
Mouse brains were analyzed histologically by hematoxylin and eosin (H&E) stained coronal sections. Our analysis of coronal sectioned brain at P14 failed to find significance when comparing the total area in section (499.2+39.9μM (Control) vs. 552.5+50.8μM (Kif6p.G555fs/p.G555fs); n=7/genotype; p=0.42). However, lateral and third ventricles (LV and 3V respectively) were obviously enlarged in Kif6p.G555fs/p.G555fs mutants (Fig 2F). Quantitation of LV volumes normalized to total brain volume confirmed ventricular expansion in Kif6p.G555fs/p.G555fs mutants (n=7 for each genotype; p≤0.05; Fig 2G). No obvious defects of the cortex or development of other brain regions in Kif6p.G555fs/p.G555fs mutant mice were apparent at a gross anatomical level (Fig 2E, F). Together these data suggest that Kif6p.G555fs/p.G555fs mutant mice display postnatal-onset, progressive hydrocephalus, without obvious overgrowth of neural cortex.
Kif6 is Expressed Specifically in the ECs of the Mouse Brain
To determine the endogenous expression patterns of Kif6 in the mouse, we isolated a Kif6-LacZ reporter mouse (Kif6-LacZtm1b) (KOMP repository, see Methods and Materials). Hemizygous Kif6-LacZtm1b/+ mice appeared unremarkable and exhibited no evidence of hydrocephalus. Intercrosses of Kif6tm1b/+ hemizygous mice failed to generate litters with Kif6tm1b/tm1b homozygous mice, suggesting that the homozygosity of the lacZ expressing allele is embryonic lethal (data not shown). At P10 and P21, Kif6tm1b/+ transgenic mice showed lacZ expression throughout the ependyma of the ventricular system including the central canal. However, no lacZ expression was detected in the choroid plexus or in other regions of the brain (Fig 3A, A’ and S3B’ Fig), with the exception of a small population of cells flanking the third ventricle (arrows, S3 Fig). Interestingly at P10, other multi-ciliated tissues in these transgenic mice such as the oviduct or trachea were not labeled (Fig 3B-C’). Moreover, no laterality defects or obvious changes to trachea cilia were observed in Kif6p.G555fs/p.G555fs mutant mice (S6A, B Fig), suggesting that Kif6 expression and function are tightly restricted to the multiciliated EC in mouse. Taken together these data suggested a cellular mechanism centered on defective ECs underlying the development of hydrocephalus in Kif6p.G555fs/p.G555fs mutant mice.
Progressive Loss of Cilia in Kif6p.G555fs/p.G555fs Mutant Mice
Defects in ECs and their cilia are known to cause hydrocephalus in mouse [8]. To assay EC cilia, we utilized scanning electron microscopy (SEM) to directly visualize the LV. Heterozygous Kif6p.G555fs/+ mice displayed a high-density of regularly spaced EC multiciliated tufts along the LV surface (Fig 4A-A’), typical for P21 mice [22]. In contrast, homozygous Kif6p.G555fs/p.G555fs mutant mice displayed a marked reduction of multiciliated tufts across the LV wall, coupled with a reduction in the density of ciliary axonemes extending from the ECs (Fig 3B-B’). The loss of EC cilia was more severe at P28 (S4 Fig). Together, these data suggested that hydrocephalus may result from either a reduction in EC differentiation and/or defects in EC cilia maintenance during postnatal development.
To address the differentiation status of the ECs, we utilized immunofluorescence (IF) in coronal sectioned brain tissues to image known proteins components of the EC and their cilia. At P21, we observed the expression of the ependymal cell-marker S100B [22] throughout the epithelium lining luminal surface of the ventricles, as well as, the presence of apically localized g-tubulin-positive basal bodies within these ECs in both WT (Fig 4C-C”) and Kif6p.G555fs/p.G555fs mutant mice (Fig 4D-D”). Conversely, we observed a severe reduction in the density of CD133-positive EC axonemes [23] extending into the ventricular lumen in Kif6p.G555fs/p.G555fs mutant mice (Fig 4C, C”’), compared with WT (Fig 4D, D”’). Quantitation of several sections from independent mice confirmed a severe reduction of CD133-positive ciliary axonemes due to the loss of KIF6 function (n=5 mice/genotype, p<0.001) (Fig 4E). These results suggest that the onset of hydrocephalus in Kif6 mutant mice is primarily due to the loss of EC ciliary axonemes and not the result of defects in the differentiation of these cells.
Ventricular Dilation and Reduced EC Cilia in kif6 Mutant Zebrafish
Previous studies in kif6sko/sko mutant zebrafish found late-onset scoliosis, without obvious hydrocephalus or defects in EC cilia during early embryonic development [19]. Interestingly, reduced CSF flow, ventricular dilation, and loss of EC cilia during larval zebrafish development is associated with scoliosis [24]. In order to determine if kif6 mutant zebrafish display changes in the ventricular system later in adults, we used iodine contrast-enhanced, micro computed tomography (μCT) [25] to generate high-resolution (5 μM) images of the intact zebrafish brain. After reconstruction and alignment of 3D tomographic datasets in the coronal plane, we utilized stereotyped landmarks of the zebrafish brain and spinal cord [26] to compare equivalent axial sections of aged matched (90 days post fertilization (dpf)) kif6sko/+ heterozygous and kif6sko/sko homozygous mutant zebrafish. At each axial level of the brain (Fig 5A), we observed consistent dilation of the ventricular system and central canal in kif6sko/sko homozygous mutant zebrafish (yellow arrows; Fig 5C, E, G), compared to a stereotyped anatomy of the wild-type (WT) zebrafish brain (Fig 5B, D, F). Multiple regions of kif6sko/sko mutant zebrafish brain were found to be structurally abnormal in kif6sko/sko mutants compared to WT zebrafish (S1, 2 Movies). We next quantified the areas of two anatomically distinctive ventricles in our tomographic datasets: (i) the tectal ventricle (TecV) and (ii) a region of the rhombencephalic ventricle (RV) just posterior to the lobus facialis [26]. We found that both the TecV and the posterior RV were significantly more dilated in kif6sko/sko mutant zebrafish comparing several optical sections from independent aged-matched zebrafish (n=3 fish/genotype; p<0.0001). The central canal was also clearly dilated in kif6sko/sko mutant zebrafish (yellow arrow, Fig 5G). However, we were unable to reliably quantify this area in WT samples at the current resolution. Our previous observations in kif6sko/sko mutant zebrafish embryos failed to find phenotypes that are characteristic of cilia defects, such as hydrocephalus, situs inversus, or kidney cysts [19]. Moreover, we observed normal development and function of EC cilia in the central canal in embryonic mutant zebrafish [19]. These data, together with our new observations of ventricular dilation in adult kif6 mutants (Fig 5), suggest that Kif6 is required for the post-embryonic maintenance of the EC cilia as was observed in other zebrafish mutants displaying similar scoliosis as observed in kif6 mutant zebrafish [19, 24].
In order to assay whether EC cilia were affected in adult (90dpf) kif6sko/sko mutant zebrafish, we isolated a stable transgenic allele, Tg(Foxj1a:GFP)dp1 which effectively labels multiple multiciliated Foxj1a-positive cell lineages, including ECs, with cytoplasmic EGFP in zebrafish [24]. We observed no differences in the specification of Foxj1a:GFP-positive ECs comparing WT and homozygous kif6sko/sko mutant fish (Fig 5I, J). Cytoplasmic GFP can freely diffuse into and label the ciliary axoneme [27]. As such, we were able to observe GFP-positive EC cilia projecting into the ventricular lumen in Tg(Foxj1a:GFP)dp1; kif6sko/+ heterozygous fish (red arrowheads; Fig 5I). In contrast, these GFP-labeled EC cilia were reduced or absent in Tg[Foxj1a:GFP]dp1; kif6sko/sko mutant fish (Fig 5J, K). Furthermore, SEM analysis of the ventricles in kif6sko/sko mutant zebrafish further supported our observations of ventricular dilation and loss of EC cilia in adult kif6sko/sko mutant fish (S5 Fig). Akin to our observations in Kif6 mutant mice trachea, we did not observe defects of other multiciliated tissues such as the nasal cilia (S6C, D Fig) in kif6sko/sko mutant zebrafish. Together, these data suggest that Kif6 functions specifically in the maintenance of EC cilia as well as for ventricular homeostasis in zebrafish.
DISCUSSION
This study demonstrates the importance of KIF6 for neuro-cranial development in vertebrates, and a unique and highly specialized role in ependymal cells where its function is important for maintenance of EC cilia. This is supported by several lines of evidence including the discovery of a novel nonsense-mutation of KIF6 in a child with neuro-cranial defects and intellectual disability and underscored by functional analysis in both mouse and zebrafish Kif6 mutant models (Table 2).
We identified a homozygous KIF6 c.1193delT mutation in a child with macrocephaly and cognitive impairment that segregated with this phenotype in his family, and leads to a loss of the C-terminal second and third coiled-coil regions which are important for dimerization and cargo selectivity of kinesin motors [13]. We engineered an analogous, C-terminal truncating mutation of KIF6 in mouse, which displays severe hydrocephalus and defects of EC cilia providing strong evidence for pathogenicity of the mutation in the child. Other than the case described here, no prior mutation directly attributed to human disease has been described for KIF6. Taken together, the clinical data reported here suggest that biallelic mutations in KIF6 may underlie some unexplained intellectual disability and neuro-cranial developmental defects. Future analyses of KIF6 mutations in these patient groups are warranted.
Further, our analysis of several independent loss-of-function Kif6 mutant animal models found no evidence of obvious heart abnormalities to explain the prior association of the common variant KIF6 p.W719R in some[17], but not all [18], studies of coronary heart disease in humans. Because expressed sequence tag clones of KIF6 have not been reported from cDNAs libraries derived from human heart or vascular tissues (UniGene 1956991 - Hs.588202), any possible functional effects of KIF6 on heart function remains unexplained. However, detailed analysis of coronary function was not explored in our models, therefore it is possible that subtle defects may be present.
An ENU-derived Kif6 splice acceptor site mutant mouse strain, predicted to delete the 3rd exon of KIF6 (Kif6Δ3/Δ3), also did not show cardiac or lipid abnormalities [28]. Of note this mutant mouse was also not reported to have hydrocephalus. Our analysis shows that the loss of exon 3 in Kif6Δ3/Δ3 mutant mouse generates an inframe deletion of only 25 amino acids in the N-terminal motor domain of the KIF6 protein, otherwise generating a mostly full-length KIF6 protein (Table 2). In contrast, here we report two novel Kif6 mutant mice: (i) a C-terminal Kif6p.G555fs/p.G555fs deletion mutant, predicted to truncate 248 amino acids of the C-terminal domain, which are important for cargo binding in Kinesin motor proteins [13]; and (ii) a conditional CMV-Cre;Kif6tm1c/tm1c mutant which recombines exon 4 leading to an early frame shift mutation predicted to generate a N-terminal truncated 122 amino acid KIF6 protein (Table 2), both of which display indistinguishable progressive, hydrocephalus. The most parsimonious explanation for the difference in phenotypes in these mutant mice is that the Kif6Δ3 allele encodes a functional KIF6 protein. Analysis of these mutations in trans or quantitative analysis of these kinesin motor proteins in vitro is warranted to more fully address these conflicting observations.
There are marked differences in the phenotypes among the human, mouse, and zebrafish associated with mutations in KIF6. For example, kif6 mutant zebrafish display post-natal onset scoliosis, mirroring adolescent idiopathic scoliosis (IS) in humans [29]. The formation of IS-like defects in zebrafish has been shown to be the result of a loss of CSF flow, associated with a loss of EC cilia and ventricular dilation during a defined window of larval zebrafish development [24]. Interestingly, we did not observe scoliosis in the Kif6 mutant mice (S7 Fig), despite being of an appropriate age when IS-like scoliosis can manifest in mouse [30]. Moreover, we do not observe scoliosis in the patient at the age of 10 years, though it is possible that he may yet develop scoliosis during adolescence. The mechanism behind these differences may reflect distinctions in the functional input of the ventricular system for spine stability amongst teleosts and amniotes.
Furthermore, while we observe a clear role for KIF6 in maintaining the ventricular system in mouse and zebrafish, the patient does not have obvious hydrocephalus. However, his relative macrocephaly and slightly enlarged ventricles by MRI (Fig 1B-D) may suggest an element of what is commonly referred to as arrested hydrocephalus [31]. The contribution of EC cilia beating to bulk CSF flow might be species dependent. For instance, the majority of CSF flow in humans is thought to occur via the generation of a source-sink gradients; partly from the secretion of the choroid plexus and exchanges of the interstitial fluids, coupled with absorption at the arachnoid villi and lymphatics [32]. In contrast, localized or near-wall CSF flow [4], generated by polarized beating of EC cilia, are clearly important for the formation of hydrocephalus in rodents [8]; however, there have been limited examples EC cilia defects causing hydrocephalus in humans. Regardless there is growing evidence suggesting that EC cilia dependent CSF flow is crucial for the regulation of brain function and neurogenesis [4], and for adult neural stem cell proliferation [9]. It is possible that a specific loss of EC cilia in humans may only have minor effects on CSF bulk flow and ventricular homeostasis, while causing severe defects of neurogenesis leading to intellectual disability and other neurological disease. It will be important to determine if the loss of KIF6 function in adulthood will contribute to changes in neurodevelopment and behavior, cognitive decline, and ventricular homeostasis.
Finally, KIF6 now joins five other kinesin genes, KIF1C, KIF2A, KIF4A, KIF5C and KIF7 that were previously reported to be associated with neurological abnormalities in humans [33–36]. Here we suggest that KIF6 has a uniquely specific function in the EC cilia in vertebrates, resulting in both cognitive impairment and macrocephaly in a child with a homozygous one-base pair deletion. Using a cell biological approach, we identified specific loss of EC cilia in Kif6 mutant models in both mouse and zebrafish, suggesting a strong conservation of KIF6 function in ventricular system in vertebrates.
Material and Methods
Identification of Mutation in Patient 1
Whole Exome Sequencing (WES)
The patient’s genomic DNA of patient was extracted from peripheral blood leukocyte using AchivePure DNA Blood Kit (5 Prime Inc., Gaithersburg, MD). The sample was sent to Macrogen, Inc. (Seoul, Korea) for whole exome sequencing. The 4 ug of DNA sample was enriched by TruSeq Exome Enrichment Kit and was sequenced onto Hiseq 2000. The raw data per exome was mapped to the human reference genome hg19 using CASAVA v1.7. Variants calling were detected with SAMtools.
Homozygosity mapping
The sample was sent to Macrogen, Inc. (Seoul, Korea) for genotyping. The DNA sample was genotyped by HumanOmni 2.5-4v1 DNA BeadChip (Illumina) which contain 2,443,177 SNPs. The experiment was performed by the array protocol. PLINK was used to analyze for the homozygous regions.
Mutation analysis
We performed resequencing of KIF6 pathogenic region in patient and patient’s family. Primers for the amplification of the candidate variant were designed using Primer 3 software (version 0.4.0). Primers KIF6-1193delT-F 5’-CAGCTTGAACATGGCTGAAA-3’ and KIF6-1193delT-R 5’-TTCTGTAAAGAGGTGGGAACAA-3’were used to amplify. The 20 ul of PCR reaction contained 50-100 ng of genomic DNA, 200 uM of each dNTP, 150 nM of each primer, 1. 5 mM MgCl2 and 0.5 unit of Taq DNA polymerase (Fermentas Inc., Glen Burnie, MD). The PCR condition was started with 95 °C for 5 min for pre-denaturation following with the 35 cycles of 94 °C for 30 sec, 55 °C for 30 sec and 72 °C for 30 sec. The product size of these primers is 276 bp. For sequencing, PCR products were treated with ExoSAP-IT (USP Corporation, Cleveland, OH), and sent for direct sequencing at Macrogen Inc. (Seoul, Korea). Bi-directional sequencing was done by using KIF6-1193delT F and R primers. Analyses were performed by Sequencher 4.2 (Gene Codes Corporation, Ann Arbor, MI).
PCR-RFLP
One hundred chromosomes and patient’s trio were genotyped by PCR-RFLP. Primer KIF6 MfeI F 5’-TGGCTTCACTATAAATTTCACTTTGTCAATG-3’ and mutagenic primer KIF6 mutagenic MfeI R 5’-TCCTGGTCTTCCAAAAAGGATGCAAT-3’were used to amplify KIF6 T-deletion. The 20 ul of PCR reaction contained 50-100 ng of genomic DNA, 200 uM of each dNTP, 150 nM of each primer, 1.5 mM MgCl2 and 0.5 unit of Taq DNA polymerase (Fermentas Inc., Glen Burnie, MD). The PCR condition was started with 95 C for 5 min for pre-denaturation following with the 35 cycles of 94 C for 30 sec, 60 C for 30 sec and 72 C for 30 sec. The product size of these primers is around 223 bp. The PCR product was incubated with 10U of Mfe-HF (New England Biolabs, Ipswich, MA) at 37 C overnight. Three percent of agarose gel electrophoresis was used to detect the different cut sizes of PCR product. A 196 bp and 26 bp bands were present in one base deletion sample.
Mice
All mouse studies and procedures were approved by the Animal Studies Committee at the University of Texas at Austin (AUP-2015-00185). The Kif6p.G555fs mutant mouse were developed using CRISPR-Cas9-mediated genome editing. Using the CHOP-CHOP online tool [37], we identified a suitable 20-nucleotide site (GGAGATGTCACTGGGACGCC) targeting exon 14 of mouse Kif6 (ENSMUST00000162854.1) in order to generate a C-terminal truncation allele. The gene specific and universal tracrRNA oligonucleotides (S3 Table) were annealed, filled in with CloneAmp HiFi PCR premix, column purified, and directly used for in vitro transcription of single-guide RNAs (sgRNAs) with a T7 Polymerase mix (M0255A NEB). All sgRNA reactions were treated with RNAse free-DNAse. We utilized a ssDNA oligo (S3 Table) to insert a frameshift mutation in all three reading frames, along with 8-cutter restriction sites for genotyping (3-stop donor) [38] (Fig S2). The Kif6 ex14 3-stop donor and mKif6-R2-ex14-T7 sgRNA were submitted for pronuclear injection at the University of Texas at Austin Mouse Genetic Engineering Facility (UT-MGEF) using standard protocols (https://www.biomedsupport.utexas.edu/transgenics). We confirmed segregation of the Kif6p.G555fs allele using several methods including increased mobility on a high percentage electrophoresis gel, donor-specific primer PCR, or PmeI (NEB) digestion of the Kif6 exon14 amplicon (S2 Fig and S3 Table). PCR products in isolated alleles were cloned to pCRII TOPO (ThermoFisher) to identify scarless integration of the 3-stop donor at the Kif6 locus using gene specific flanking primers (S3 Table).
Kif6-LacZtm1b mice were generated by injection of embryonic stem cell clones obtained from the Knockout Mouse Project (KOMP) Repository. Three Kif6tm1a(KOMP)Mbp embryonic stem (ES) cell clones (KOMP: EPD0736_3_G01; EPD0736_3_H02; and EPD0736_3_A03) all targeting exon 4 of the Kif6 gene with a promoter-driven targeting cassette for the generation of a ’Knockout-first allele’ [39]. Pronuclear injections of all clones were done using standard procedures established by the UT MGEF. After screening for germline transmission, we isolated and confirmed a single heterozygous founder male (Kif6tm1a(KOMP)Mbp) carrier derived from the G01 clone. We confirmed the locus by long-range PCR, several confirmation PCR strategies targeting specific transgene sequences, and Sanger sequencing of the predicted breakpoints (S3 Table). After several backcrosses to the WT C57BL/6J substrain (JAX), we crossed a hemizygous Kif6tm1a/+ mutant male to a homozyogus CMV-Cre female (B6.C-Tg(CMV-cre)1Cgn/J) (JAX, 006054) to convert the Kif6tm1a allele to a stable LacZ expressing Kif6tm1b allele (Kif6-LacZtm1b). Mutant F1 offspring from this cross were backcrossed to WT C57BL6/J mice and the F2 progeny were genotyped to confirm the Kif6-LacZm1b allele and the presence/absence of the CMV-Cre transgene. A single founder Kif6-LacZtm1b with the desired genotype (Kif6-LacZtm1b hemizygous, Cre transgene absent) was used to expand a colony for spatial expression analysis.
Kif6tm1c conditional ready mice were generated by outcross of the Kif6tm1a(KOMP)Mbp allele described above to a ubiquitously expressed Flippase strain (129S4/SvJaeSor-Gt(ROSA)26Sortm1(FLP1)Dym/J) (JAX, 003946). F1 offspring were genotyped and sequenced at several breakpoints to ensure proper flip recombination and a single F1 founder was used to backcross to C57B6/J for propagation of the Kif6tm1c strain. Analysis of recombination of the floxed Kif6tm1c was performed by crossing homozygous Kif6tmlc/tmlc to a compound heterozygous CMV-Cre; Kif6tm1c/+ mouse. Recombination of the exon 4 of Kif6 was confirmed by PCR-gel electrophoresis analysis (S3 Table).
LacZ Staining Protocol
Mice were perfused with LacZ fixative and post fixed for 2 hours at RT. Whole brains were then stained in X-gal solution overnight at 37°C followed by post-fixation in 4% PFA overnight at 4°C. The samples were then prepped for cryosectioning in 30% sucrose/OCT and sectioned. Sections were counter stained in Nuclear Fast Red stain (Sigma).
X-ray Analyses of Mice
Radiographs of the mouse skeleton were generated using a Kubtec DIGIMUS X-ray system (Kubtec, T0081B) with auto exposure under 25 kV.
Zebrafish Manipulations and Transgenesis
All zebrafish studies and procedures were approved by the Animal Studies Committee at the University of Texas at Austin (AUP-2015-00187). Adult zebrafish of the AB were maintained and bred as previously described [40]. Individual fish were used for analysis and compared to siblings and experimental control fish of similar size and age. Independent experiments were repeated using separate clutches of animals. Strains generated for this study: Tg(Foxj1a:GFP)dp1. Previously published strains: kif6sko [19]. Transgenic lines were generated using the Tol2-system as described before [41].
Mouse and Zebrafish Perfusions and Embedding of Brain Tissues
Mice were humanely euthanized by extended CO2 exposure and transferred to chemical hood where the mouse was perfused with buffered saline followed by 4% PFA. Whole brains were placed in 4% PFA 4 hours at RT, then at 4° C overnight. Zebrafish were euthanized by exposure to lethal, extended dose of Tricane (8%) followed by decapitation. Zebrafish brains were extracted and fixed in 4% PFA at 4° C overnight. For paraffin embedding, the fixed brains were embedded and cut using standard paraffin embedding and sectioning protocols. Paraffin sections were stained with standard hematoxylin-eosin solution.
For frozen sections both mouse or zebrafish brains were fixed as above and then equilibrated to 30% or 35% sucrose, respectively at 4° C overnight. Whole brains were then placed in O.C.T. Compound (Tissue-Tek) and flash in cold ethanol bath. All blocks were stored at -80° Celsius until sectioning on a cryostat (Leica). All sections were dried at RT for ~2hrs. and stored at -80°C until use.
Immunofluorescence Protocol for Frozen Brain Sections
Sectioned tissues were warmed at room temperature for ~1 hour, then washed thrice in 1xPBS + 0. 1% Tween (PBST). Antigen retrieval was hot citrate buffer (pH6.8). Blocking was done in 10% Normal goat serum (Sigma) in 1xPBST. Primary antibodies (S100B at 1:1,000, ab52642, Abcam; CD133(Prominin-1), 134A, 1/500; Gamma Tubulin, sc-17787, Santa Cruz (C-11), 1/500; Anti-GFP, SC9996, Santa Cruz, 1:1,000) were diluted in 10% NGSS, 1xPBST and allowed to bind overnight at 4°C in a humidified chamber. Secondary fluorophores (Alexa Fluor 488(A-11034); 568(A10042); and 647(A32728), 1:1,000, ThermoFisher) were diluted in 10% NGS; 1xPBST were allowed to bind at RT for ~1hr. We used Prolong gold with DAPI (Cell Signaling Technologies, 8961) to seal coverslips prior to imaging.
Iodine-contrast μCT
Zebrafish specimens were fixed overnight in 10% buffered formalin, washed thrice in diH2O and stained ~48 hours in 25% Lugol’s solution/75% distilled water. Specimens were scanned by the High-resoultion X-ray CT Facility (http://www.ctlab.geo.utexas.edu/) on an Xradia at 100kV, 10W, 3.5s acquisition time, detector 11.5 mm, source -37 mm, XYZ [816, 10425, -841], camera bin 2, angles ±180, 1261 views, no filter, dithering, no sample drift correction. Reconstructed with center shift 5.5, beam hardening 0.15, theta -7, byte scaling [-150, 2200], binning 1, recon filter smooth (kernel size =0.5).
Statistical Analysis and image measures
GraphPad Prism version 7.0c for Mac (GraphPad Software) was used to analyze and plot data. Images for measurement were opened in FIJI (Image J) [42], and measures were taken using the freehand tool to draw outlines on ventricular area or whole brain area. Statistically significant differences between any two groups were examined using a two-tailed Student’s t-test, given equal variance. P values were considered significant at or below 0.05.
ACKNOWLEDGMENTS
We thank members of the Gray and Wallingford labs for helpful discussions and critical reading of the manuscript. We would also like to thank Jin Xiang Ren and William Shawlot for help with mouse engineering, Terry Heckmann and Ryoko Minowa for excellent technical support. We thank Jessie Maisano for her help and expertise with iodine-contrast μCT for this study. This study was supported (V.S.) by the Thailand Research Fund (DPG6180001) and the Chulalongkorn Academic Advancement into Its 2nd Century Project. The research of M.K. was supported in part by the Provost Graduate Excellence Fellowship, Institute of Cell and Molecular Biology, University of Texas at Austin. The research of R.S.G. was supported start-up funds from the University of Texas at Austin Dell Medical School and by a NIH grant R01AR072009.