Abstract
KRAS and EGFR have been shown to function as essential mediators of pancreatic cancer development1–4. In addition, KRAS and EGFR have been shown to interact with and perturb the function of Argonaute 2 (AGO2), a key mediator of RNA-mediated gene silencing5, 6. Here, we employed a genetically engineered mouse model of pancreatic cancer7, 8 to define the effects of conditional loss of AGO2 in KRASG12D driven pancreatic cancer. Genetic ablation of AGO2 does not interfere with development of the normal pancreas or KRASG12D driven early precursor pancreatic intraepithelial (PanIN) lesions. However, AGO2 loss prevents progression from early to late PanIN lesions, development of pancreatic ductal adenocarcinoma (PDAC), and metastatic progression. This results in a dramatic increase in survival of KRASG12D mutant mice deficient in AGO2 expression. In both mouse and human pancreatic tissues, increased AGO2 expression at the plasma membrane is associated with PDAC progression. Mechanistically, within early precursor PanIN lesions, loss of AGO2 elevates phospho-EGFR levels and activates wild-type RAS, antagonizing KRASG12D activation and PDAC development. Furthermore, we observe that phosphorylation of AGO2Y393 by EGFR6 disrupts the interaction of wild-type RAS with AGO2, but does not affect the interaction of mutant KRAS with AGO2. Taken together, our study supports a biphasic model of pancreatic cancer development: an AGO2-independent early phase of PanIN formation reliant on EGFR and wild-type RAS signaling, and an AGO2-dependent phase wherein the KRAS-AGO2 interaction is critical to the progression from PanIN to PDAC.
Mutations in RAS account for over 30% of all cancers and over 90% of pancreatic cancer harbor KRAS mutations, a disease with a dismal overall 5-year survival rate of only 7%9. The KRAS GTPase transduces extracellular mitogenic signals by cycling between an active GTP-bound and an inactive GDP-bound state. Recurrent driver mutations in KRAS decrease intrinsic GTPase activity thereby accumulating in its active GTP-bound form. Constitutively active KRAS leads to aberrant signaling activities through interactions with multiple effector proteins10–12. Recently, we identified an interaction between KRAS and Argonaute 2 (AGO2), independent of KRAS mutation status5 and similarly Shen et al identified a functional interaction between EGFR and AGO26. Here we employ an established mouse model of pancreatic cancer to explore the in vivo requirement of AGO2 in pancreatic cancer development in the context of KRAS and EGFR signaling.
To investigate the role of AGO2 in the development of pancreatic cancer in vivo, we interrogated the genetically engineered mouse model of pancreatic cancer initiated by a conditionally activated allele of KRAS7, LSL-KRASG12D (KRASG12D, shown in Fig. 1a). Crossing KRASG12D mice with animals harboring Cre recombinase under the control of pancreatic acinar cell-specific promoter, p48 (p48Cre), yields KRASG12D;p48Cre mice that develop pancreatic intraepithelial precursor lesions (PanINs) within 3 weeks of age7. Over time, these PanINs progress to pancreatic adenocarcinoma (PDAC) and develop metastases, faithfully mimicking the human disease. In order to evaluate the potential consequences of AGO2 ablation in this model, we generated transgenic mice with both KrasG12D and conditionally abrogated allele(s) of AGO213 (Fig. 1a). The resulting KRASG12D;p48Cre mice were either wild-type, heterozygous or homozygous for the conditionally expressed allele of AGO2 (hereafter referred to as AGO2+/+;KRASG12D;p48Cre, AGO2fl/+;KRASG12D;p48Cre and AGO2fl/fl;KRASG12D;p48Cre respectively). Genomic PCR confirmed Cre-driven excision and recombination of the oncogenic KRAS allele7 in pancreas from mice with KRASG12D;p48Cre alleles (Extended Data Fig. 1a). Further, qRT-PCR analysis showed significant reduction in AGO2 expression in AGO2fl/fl;KRASG12D;p48Cre mice (Extended Data Fig. 1b), confirming Cre-mediated mutant KRAS activation with concomitant loss of AGO2 expression in the pancreas.
Histological analysis of the pancreas from mice with Cre-mediated AGO2 ablation (AGO2fl/fl; p48Cre), showed normal morphology (Fig. 1b, left panels) with no differences in pancreatic weight compared to pancreata from AGO2+/+; p48Cre mice (Extended Data Fig. 2). This suggests that loss of AGO2 in the acinar cells of the exocrine compartment, does not interfere with gross pancreas development. Immunohistochemical (IHC) staining with antibodies specific to AGO2 (Extended Data Fig. 3 and Extended Data Table 1) showed minimal expression of AGO2 in the acinar and ductal cells of both AGO2+/+; p48Cre and AGO2fl/fl; p48Cre pancreata (Fig. 1b, right panels). Interestingly, relatively higher expression of AGO2 was seen in pancreatic endocrine cells (islets of Langerhans), which was unaffected by the acinar cell-specific ablation of AGO2. These data indicate a non-essential role for AGO2 in the acinar cells for normal pancreatic development. However, expression of KRASG12D in the pancreatic acinar cells led to increased AGO2 expression in the PanINs as well as the surrounding stroma in 12 week old AGO2+/+;KRASG12D;p48Cre mice (Fig. 1c, top panels). Notably, we observed PanIN lesions in AGO2fl/fl;KRASG12D;p48Cre pancreas lacking AGO2 expression (Fig. 1c, lower panels). These early stage precursor PanIN lesions in AGO2fl/fl;KRASG12D;p48Cre pancreas were morphologically indistinguishable from those arising in AGO2+/+;KRASG12D;p48Cre mice. Curiously, while PanIN lesions in AGO2fl/fl;KRASG12D;p48Cre mice fail to exhibit detectable AGO2, the surrounding stromal cells continue to express relatively high levels of AGO2. Further, PanINs from both AGO2+/+;KRASG12D;p48Cre and AGO2fl/fl;KRASG12D;p48Cre mice displayed high mucin content as seen by Alcian blue staining14 and similar pancreatic weights, indicating indistinct phenotypes at the 12-week time point (Extended Data Fig. 4).
Surprisingly, over a longer course of time, mice aged over 400 days (57 weeks) showed significantly increased pancreatic weights in both the AGO2+/+;KRASG12D;p48Cre and AGO2fl/+;KRASG12D;p48Cre cohort compared to AGOfl/fl;KRASG12D;p48Cre mice, indicative of a higher tumor burden in mice with at least one functional allele of AGO2 (Fig. 1d). Histological analysis of pancreata at the 400 day time point shows early/late PanIN lesions and some PDAC development in AGO2+/+;KRASG12D;p48Cre and AGO2fl/+;KRASG12D;p48Cre mice with a distribution consistent with those reported previously4, 15. However, in the AGO2fl/fl;KRASG12D;p48Cre mice, mostly early stage PanIN lesions were observed, with no evidence of PDAC (Fig. 1e). Occasionally, higher grade PanIN lesions were observed in AGO2fl/fl;KRASG12D;p48Cre pancreata, but these lesions invariably showed AGO2 expression (Extended Data Fig. 5), indicative of likely escape from Cre recombination as noted previously in other contexts4, 16. In order to determine the effect of AGO2 loss on tumor-free survival, a cohort of transgenic mice was monitored over 500 days. Twelve of 12 AGO2+/+;KRASG12D;p48Cre and 18 of 19 AGO2fl/+;KRASG12D;p48Cre mice died over a median of 406 and 414 days respectively, typical for a murine model expressing KRASG12D in the pancreas8, 17, 18. Remarkably, however, all 12 of 12 mice with homozygous AGO2 deficiency (AGO2fl/fl;KRASG12D;p48Cre) had survived at the cut-off time point of 500 days (Fig. 1f). PDAC was observed in pancreata of all mice that express AGO2 (wild type or heterozygous expression) but mice deficient for AGO2 developed only early PanIN precursor lesions without progression to PDAC (Fig. 1g). Necropsy of experimental mice from the different genotypes were also assessed for grossly visible metastases and abnormal pathologies19 and revealed frequent metastases in the AGO2+/+;KRASG12D;p48Cre and AGO2fl/+;KRASG12D;p48Cre genotypes, but mice from AGO2fl/fl;KRASG12D;p48Cre rarely showed abnormal pathologies, and never frank adenocarcinoma or metastases (Fig. 1g). While all metastatic lesions from mice expressing AGO2 showed PDAC, analysis of lungs with abnormal pathologies in two of the AGO2fl/fl;KRASG12D;p48Cre mice (marked as gray boxes) showed a single benign lesion each, associated with AGO2 expression (representing lesions with non-recombined alleles/non pancreatic origin) without indication of PDAC (Extended Data Table 2 and Extended Data Fig. 6). One mouse of the AGO2fl/fl;KRASG12D;p48Cre genotype developed a pancreatic cyst (without AGO2 expression), histologically resembling the mucinous cystic neoplasm and survived for 368 days (Extended Data Table 2 and Extended Data Fig. 6). Taken together, these data suggest that AGO2 is not essential for either normal pancreatic development or KRASG12D driven PanIN formation, however AGO2 is indispensable for progression of PanIN to PDAC.
Consistent with a role of AGO2 in KRAS driven oncogenesis in the AGO2+/+;KRASG12D;p48Cre mice, IHC analysis showed increased levels of AGO2 in PDAC and metastatic tissues as compared to early PanIN lesions (Fig. 2a). This suggests that AGO2 protein levels are elevated with disease progression. To extend these analyses to human pancreatic cancer, we performed a systematic IHC analysis of a human pancreatic tissue microarray (TMA), containing 44 duplicated pancreatic tissue cores, including PanIN, PDAC and metastatic PDAC samples. We observed a remarkable increase in AGO2 expression in PDAC and metastatic PDAC cells compared to PanINs (Fig. 2b), scored as statistically significant (Fig. 2c). Furthermore, AGO2 staining appeared to be particularly intense along the membranes of PDAC and metastatic PDAC cells, potentially consistent with proximity to KRAS at the plasma membrane20. To specifically test this, we performed dual immunofluorescence (IF) staining for AGO2 and KRAS on a pancreatic TMA. As expected, both KRAS specific and pan-RAS antibodies showed positive staining at the membrane. Consistent with our hypothesis, significant AGO2 staining was noted at the plasma membranes of human PDAC and metastatic PDAC cells, where it co-localized with KRAS (Fig. 2d and Extended Data Fig. 7). These observations support the notion that in vivo, AGO2 and KRAS interact at the plasma membrane, the main locus of RAS activity12, 20.
Since the KRAS-AGO2 interaction was previously shown to result in the attenuation of AGO2-mediated gene silencing potentiating oncogenic KRAS driven cellular transformation, here we sought to explore if AGO2 and RAS cooperate mechanistically to drive pancreatic cancer in vivo. Earlier, using cell line models we observed that mutant KRAS, but not wild-type RAS reduced the levels of tumor suppressor microRNAs like the let-7 family members and elevated levels of oncogenic microRNA like mir-2215. Here, we performed qRT-PCR analysis to interrogate expression levels of over 300 microRNAs from pancreata of AGO2+/+;KRASG12D;p48Cre and AGO2fllfl;KRASG12D;p48Cre mice, using AGO2+/+;p48Cre as reference. Interestingly, microRNA expression profiles of PanIN lesions with or without AGO2 expression were similar to each other- altogether distinct from normal pancreas (Extended Data Fig. 8a). Of note, the let-7 family tumor suppressor microRNAs21 were downregulated and the oncogenic miR-21 levels were upregulated, to the same extent in all PanINs regardless of AGO2 expression, suggesting that microRNA regulation by KRASG12D phenocopies AGO2 loss (Extended Data Fig. 8b). Thus, microRNA regulation per se does not account for progression of PanINs to PDAC. This is consistent with previous observations that changes in microRNA profiles alone do not dictate mutant KRAS oncogenesis22. Further, in an orthogonal analysis, we investigated if the endonuclease activity of AGO223 was essential to promote KRASG12D oncogenesis. In vitro foci formation assays were performed in AGO2−/- NIH3T3 cells using KRASG12D co-transfected with different AGO2 mutants5. As seen in Extended Data Fig. 9, both the wild type AGO2 and slicer deficient AGO2E637A mutant24, but not the RAS-binding deficient5 double mutant, AGO2K112A/E114A efficiently potentiated KRASG12D driven foci formation. Together, these data suggest that while the RAS-AGO2 interaction is critical, AGO2-mediated RISC activity is not required for KRASG12D driven pancreatic cancer.
Next, we sought to explore if AGO2-mediated alteration of RAS signaling in the early stage PanINs could account for the lack of progression to PDAC in the AGO2fl/fl;KRASG12D;p48Cre mice. For this, we specifically focused on EGFR-RAS signaling for two reasons: 1) EGFR has been shown to be essential for PanIN formation in the KRASG12D driven pancreatic mouse model that we have used3, 4, 25 and 2) EGFR activation has been shown to directly inhibit AGO2 function through phosphorylation of its Tyr393 residue6. Immunoblot analysis of pancreatic tissues from 12-week old mice with AGO2+/+;KRASG12D;p48Cre, AGO2fl/+;KRASG12D;p48Cre and AGO2fl/fl;KRASG12D;p48Cre genotypes showed markedly elevated phospho-EGFR (Y1068) levels in tissues with AGO2 ablation (Fig. 3a and Extended Data Fig. 10), indicating activated EGFR signaling. Further, IHC analysis showed that the elevated phospho-EGFR levels observed in tissue lysates were restricted to the PanIN lesions of the pancreas in AGO2fl/fl;KRASG12D;p48Cre mice (Fig. 3b). Immunoblots also showed that EGFR activation was accompanied with a remarkable increase in total RAS levels, however, without significant changes in the expression of oncogenic KRASG12D (Fig. 3a and Extended Data Fig. 10), raising an intriguing possibility that in early stage PanINs growth factor activation involves signaling along the EGFR-wild-type RAS axis. To investigate this further, we isolated pancreatic ducts from 12 week old AGO2+/+;KRASG12D;p48Cre and AGO2fl/fl;KRASG12D;p48Cre and cultured them as organoids26, in the absence of EGF (Extended Data Fig. 11). Immunoblot analysis showed increased levels of phospho-EGFR and total RAS in the organoids with AGO2 loss, while KRASG12D expression showed no change (Fig. 3c), mirroring the observations from pancreatic tissue lysates. Furthermore, analysis of RAS activation displayed higher levels of KRASG12D-GTP in the organoids expressing AGO2 compared to those lacking AGO2. Remarkably, the total RAS levels (which includes both wild-type and mutant RAS) as well as total RAS-GTP was higher in organoids deficient in AGO2. The increased fraction of activated wild-type RAS was accompanied with reduced proliferation rate observed in the organoids with AGO2 loss as compared to AGO2 intact organoids (Fig. 3d). These data suggest that loss of AGO2 reduces mutant KRAS function, through activation of wild-type RAS; this is consistent with the tumor suppressor-like function attributed to wild-type RAS15, 27, 28. Importantly, this data also identifies a previously unknown role for AGO2 in limiting wild-type RAS activation through feedback regulation of EGFR in mutant KRAS expressing cells. To probe if AGO2 loss can activate wild type RAS in the absence of mutant KRAS, we performed immunoblot analysis and RAS activation assays using AGO2−/- mouse embryonic fibroblasts (MEFs)29 that do not harbor any form of oncogenic RAS. As seen in Fig. 3e, AGO2 null MEFs also show increased phospho-EGFR and wild type RAS levels along with elevated wild type RAS-GTP levels, and the activation of downstream signaling through ERK and AKT. This signaling cascade is significantly reduced in the same cells rescued with AGO2. Given that AGO2 is a direct phosphorylation substrate of the EGFR kinase6, our experiments detailed in Fig. 3, define a previously unknown reverse feedback regulation of EGFR via AGO2 that controls wild type RAS activation30–33. Since AGO2 loss prevents PanIN to PDAC progression, the active EGFR-wild type RAS signaling likely interferes with mutant KRAS function.
Considering that the pancreatic mouse model with loss of AGO2 expression shows activation of both EGFR and wild-type RAS (Fig. 3), we posited that AGO2 binding to KRAS may represent a rate limiting step in the activation of wild-type KRAS during growth factor stimulation. To explore this premise, we assayed a panel of cell lines expressing wild-type or mutant RAS, stimulated with EGF, for the KRAS-AGO2 interaction. Interestingly, EGF stimulation resulted in a dramatic reduction in KRAS-AGO2 binding in cells with wild-type KRAS, as assessed in MCF-7, PC3, A375 and HeLa cells (Fig. 4a and Extended Fig. 12). However, EGF stimulation in cells harboring oncogenic KRAS, including A549 (KRASG12S), MIA Paca-2 (KRASG12C) and Capan-1 (KRASG12V) retained binding of endogenous KRAS and AGO2, despite activation of the EGFR/MAPK pathway (Fig. 4b). The disruption of the wild-type RAS-AGO2 interaction was also observed when HEK293 (KRASWT) cells expressing FLAG-tagged AGO2 were stimulated with EGF; the interaction was rescued by treatment of these cells with the EGFR kinase inhibitor, erlotinib (Fig. 4c). This strongly suggested that EGFR kinase activity was critical for the disruption of the wild-type KRAS-AGO2 interaction. In contrast, DLD-1 cells harboring mutant KRASG13D, neither EGFR kinase activation by EGF nor its inhibition by erlotinib altered the association of KRAS and AGO2 (Fig. 4d). To test if the previously identified phosphorylation of AGO2 by EGFR at tyrosine 3936 has a role in binding to KRAS, we tested the ability of a phosphorylation deficient AGO2Y393F mutant to bind RAS under different conditions. In HEK293 (KRASWT) cells, EGF stimulation led to dissociation of wild-type AGO2 from RAS but the AGO2Y393F mutant continued to bind RAS with or without EGFR activation (Fig. 4e). However, expression of these AGO2 constructs in MIA Paca-2 (KRASG12S) cells showed no discernible change in RAS binding upon EGFR activation (summarized in Fig. 4f). Together, these data suggest that the wild-type KRAS-AGO2 interaction is sensitive to EGFR mediated phosphorylation of AGO2Y393 while the oncogenic KRAS-AGO2 interaction is resistant to both EGFR activation as well as AGO2Y393 phosphorylation.
Genetically engineered mouse models have been extensively used to mirror the stepwise progression of human pancreatic cancer, starting with the benign precursor lesion (PanINs) driven by mutant KRAS8, 34, 35. In this study we demonstrate that genetic loss of AGO2 locks KRAS induced pancreatic cancer development in the PanIN stage. AGO2 expression is seen as a critical requirement for progression of PanIN to PDAC. In the absence of AGO2, even the formation of alternate precursor lesions and anaplastic PDAC are not observed, which are described as bypass routes to oncogenesis as noted with NOTCH2 loss36. Progression from PanIN to PDAC also does not require the microRNA-mediated RNA silencing function of AGO2 and likely explains why overlapping RISC activities of other Argonaute family members37 fail to compensate for AGO2 loss. AGO2 ablation in the PanINs decreases let-7 microRNA levels and increases EGFR activation together accounting for both elevated wild-type RAS levels38 and RAS activation30, 31. Taken together, our data is consistent with previous reports that PanIN development triggered by oncogenic KRAS involves a phase of EGFR activation leading to wild-type RAS signaling. Further progression to PDAC, requires the mutant KRAS-AGO2 interaction, accompanied with reduced EGFR expression4 and decreased wild-type RAS levels and activity. This nexus between EGFR, wild-type RAS and AGO2 is further supported by our observation that EGF stimulation disrupts the wild-type KRAS-AGO2 interaction, but not the oncogenic KRAS-AGO2 interaction (Fig. 4f). It is intriguing that EGFR mediated phosphorylation of AGO2 Y393 disrupts wild-type RAS binding much like AGO2-Dicer binding6, but AGO2-mutant KRAS binding is immune to AGO2 phosphorylation status. Phosphorylation of AGO2 by EGFR simultaneously inhibits the last step of microRNA biogenesis6 and activates RAS at the plasma membrane39, a previously unrecognized aspect of EGF-RAS-MAPK signaling. Yet, disruption of various protein-protein interactions through EGFR phosphorylation40–42 is a common strategy to modulate the extent of RAS activation signals at the membrane. Regulation of the RAS-AGO2 interaction through growth factor activation also allows the RAS-AGO2 interaction to remain agnostic to the nucleotide (GDP/GTP) binding status of RAS5. This is strikingly different from other RAS interactors like RAF, SOS and NF111, 43, which display preferential binding to GDP or GTP loaded forms of KRAS. EGFR regulation remains limited to the wild type RAS-AGO2 interaction since mutant KRAS, with its reduced rate of GTP hydrolysis, remains constitutively active, bound to AGO2 and refractory to mitogenic stimulation. Finally, we predict that there is an absolute requirement for AGO2 in human PDAC development and that an unregulated oncogenic KRAS-AGO2 interaction at the plasma membrane drives progression of this lethal disease.
Conflict of Interest
The authors have no conflict of interests related to this study.
Author Contributions
Mouse experimental data was generated by J.C.T, S.S., K.M.J, A.W, A.G, and G.T. Contributions to other experimental data were made by S.S., R.F.S, V.L.D, S.Z-W, M.M, J.S., I.J.A. and C.K-S. L.W. and J.S. did pathology assessment, J.S. provided the human TMA and performed IHC scoring. S.S. and A.M.C. jointly conceived the study. S.S., C.K-S. and A.M.C. wrote the manuscript. Funding and overall supervision of the study was provided by A.M.C.
Methods
Mouse strains
LSL-KRASG12D7 (Kras LSL-G12D/+) and p48Cre44 (Ptf1a-Cre or Ptf1aCre/+) mice were obtained from Marina Pasca di Magliano, University of Michigan. Conditionally floxed AGO213 (AGO2fl/fl) mice were purchased from Jackson labs (Bar Harbor, Maine). PCR genotyping for KRASG12D, p48Cre and AGO2 alleles, from DNA isolated from mouse tails, was performed using standard methodology. To generate experimental and control mice, AGO2fl/fl, p48Cre, and KRASG12D lines were intercrossed to generate AGO2fl/+;p48Cre and KRASG12D; p48Cre mice. These two lines were then intercrossed to generate the AGO1fl/fl;KRASG12D;p48Cre experimental mice. Given that mice were maintained on a mixed background; littermate controls were systematically used in all experiments (sex ratio per cohort was balanced). All animals were housed in a pathogen-free environment, and all procedures were performed in accordance with requirements of the University of Michigan IACUC.
Cre activation in acinar cells of pancreata of mice with mutant KRAS alleles was validated by genotyping using the KRASG12D conditional PCR primers 5’ gtc ttt ccc cag cac agt gc 3’, 5’ ctc ttg cct acg cca cca gct c 3′ and 5′ agc tag cca cca tgg ctt gag taa gtc tgc a 3′ according to Tyler Jacks lab protocol (https:lljacks-lab.mit.edulprotocolslgenotypinglkrascond).
Histology, immunohistochemistry and immunofluorescence
Paraffin embedded tissues from mice were processed using standard methodology. Details of the primary antibodies used for IHC are provided in Extended Data Table 1. For immunofluorescence analysis, Alexa Fluor Cyanine Cy3 Anti-Rabbit (1:200) and Cy5 AntiMouse (1:200) (Jackson Immunoresearch) were used as secondary antibodies.
Human TMA analysis
Pancreatic TMAs were developed at the Tissue and Molecular Pathology Core at the Department of Pathology, University of Michigan after IRB approval. IHC scoring was performed by a pathologist.
Quantitative microRNA and mRNA RT-PCR
Pancreatic total RNA was isolated using AllPrep DNA/RNA/miRNA Universal Kit (Qiagen). 5ng of total RNA from each sample was converted into cDNA using miRCURY™ LNA™ Universal RT microRNA PCR Universal cDNA Synthesis Kit II. Quantitative micro RT-PCR was performed using exiLENT SYBR Green master mix with microRNA ready to use PCR mix, Mouse&Rat panel I, V4.M (Exiqon, Cat # 203713) on ABI 7900HT Fast Real time PCR system(Applied Biosystems). Data was analysed using GenEX ver 6 software.
For quantitation of mRNA transcripts, RNA was extracted from the indicated samples and cDNA was synthesized using SuperScript III System according to the manufacturer’s instructions (Invitrogen). Quantitative RT-PCR was conducted using primers detailed in Extended Data Table 3 with SYBR Green Master Mix (Applied Biosystems) on the StepOne Real-Time PCR System (Applied Biosystems). Relative mRNA levels of the transcripts were normalized to the expression of the housekeeping gene GAPDH.
Pancreatic tissue lysates and immunoblot analysis
Pancreata obtained from mice were homogenized in Mg2+ containing lysis buffer. Clear lysates were separated using SDS-PAGE and processed for immunoblot analysis using standard methods. Primary antibodies used in the study are indicated in Extended Data Table 1. Particularly, Ras antibodies validated in a recent study45 are also indicated.
Isolation of pancreatic ductal organoids
Pancreatic ductal organoids obtained from 12 week old KRASG12D;p48Cre and AGO2fl/fl;KRASG12D;p48Cre mice were cultured in organoid media as described previously26. Organoids were cultured without EGF for (17 passages) 9 weeks to exclude normal duct contamination which are dependent on EGF. Ductal organoid proliferation assay was performed using Cell Titer-Glo (Promega).
RAS-GTP analysis
Protein lysates were prepared from pancreatic ductal organoids or cell lines using Mg2+ containing lysis buffer. RAF1 binding was used as a measure of RAS-GTP levels in the lysates as shown before5.
Plasmids
Full length FH-AGO2 constructs were obtained from Addgene (pIRESneo-FLAG/HA-AGO2 10822, PI:Thomas Tuschl). AGO2Y393F mutant construct was generated using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) from the FH-AGO2 plasmid described above using the primers hAGO2_Y393F_Fwd 5′AAATTCACGGACGAATGGATCTGTGTTGAAACTTGCAC3′ and hAGO2_Y393F_Rev 5′GTGCAAGTTTCAACACAGATCCATTCGTCCGTGAATTT3′. DNA sequence were confirmed using Sanger sequencing at the University of Michigan Sequencing Core.
Cell culture, transfection and EGF stimulation
All cell lines (detailed in Extended Data Table 4) were obtained from the American Type Culture Collection (ATCC). Cells were cultured following ATCC culture methods in media supplemented with the corresponding serum and antibiotics. Additionally, cells were routinely genotyped and tested bi-weekly for mycoplasma contamination. For EGF stimulation, cells were grown to approximately 80% confluence and washed with PBS three times. Cells were incubated overnight (16 hr) in serum free media. EGF stimulation was performed for 5 minutes with 100 nglul of epidermal growth factor (Gibco) at 37°C. After stimulation, cells were washed and protein lysates were prepared in K Buffer lysis buffer. For tyrosine kinase inhibition, cells were pretreated with 15 uM of Erlotinib for 1 hour prior to EGF stimulation, as described above.
HEK293 or MIA PaCa-2 cells were transfected with different AGO2 constructs using Fugene HD (Promega) or Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocols. For EGFR stimulation with transient AGO2 construct overexpression, cells were transfected approximately 16 hours prior to overnight serum starvation and EGF stimulation.
Immunoprecipitation (IP) Analysis
For immunoprecipitation analysis protein lysates were prepared in K Buffer (20mM Tris pH 7.0, 5 mM EDTA, 150mM NaCl, 1% Triton X100, 1 mM DTT, phosphatase inhibitors, and protease inhibitors). Typically,150-200 ug of protein lysates (RAS10 IP: 150 ug; AGO2 IP: 200 ug; KRAS IP: 150 ug) were pre-cleared with 10 ul of Protein AlG agarose beads (Santa Cruz) for 1 hour. Pre-cleared lysates were incubated with 5-10 ug of the indicated primary antibodies targeting protein of interest or with corresponding isotype controls overnight at 4°C. 30 ul of Protein A/G beads were then added to immune complexes and incubated for 1-3 hours at 4°C, spun, washed in 150-300 mM NaCl containing K-buffer prior to separation of immunoprecipitates by SDS PAGE. To determine the varying levels of KRAS expressed in different cells lines (with or without EGF stimulation), shown in Fig. 4., pan RAS10 antibody was used for immunoprecipitation followed by immunoblot analysis using KRAS specific SC-30 antibody.
RAS-GTP pull down assay
The RAS-RAF interaction was studied using the RBD agarose beads as per manufacturer’s instructions (Millipore). Pull down assays were performed using the lysates from pancreatic ductal organoids and cell lines as indicated. The pull down of RAS by RBD agarose beads indicates the presence of active GTP-bound RAS interacting with RAF1.
Acknowledgements
We thank Mandy Davis and Marta Hernadi-Muller for their help with processing paraffin embedded slides. We also thank Malay Mody and Markus Eberl for technical assistance and Eric Fearon for discussion. A.M.C is an American Cancer Society Research Professor and Taubman Scholar.