Abstract
An important yet poorly understood facet in the life cycle of a successful pathogen is the host-to-host transmission. Hospital-acquired infections (HAI) resulting from the transmission of drug-resistant pathogens affect hundreds of millions of patients worldwide. Klebsiella pneumoniae (Kpn), a gram-negative bacterium, is notorious for causing HAI, with many of these infections difficult to treat as Kpn has become multi-drug resistant. Epidemiological studies suggest that Kpn host-to-host transmission requires close contact and generally occurs through the fecal-oral route. Herein, we describe a murine model that can be utilized to study mucosal (oropharynx and gastrointestinal [GI]) colonization, shedding within feces, and transmission of Kpn through the fecal-oral route. Using an oral route of inoculation, and fecal shedding as a marker for GI colonization, we show that Kpn can asymptomatically colonize the GI tract of immunocompetent mice, and modifies the host GI microbiota. Colonization density within the GI tract and levels of shedding in the feces differed among the clinical isolates tested. A hypervirulent Kpn isolate was able to translocate from the GI tract and cause hepatic infection that mimicked the route of human infection. Expression of the capsule was required for colonization and, in turn, robust shedding. Furthermore, Kpn carrier mice were able to transmit to uninfected cohabitating mice. Lastly, treatment with antibiotics led to changes in the host microbiota and development of a transient super-shedder phenotype, which enhanced transmission efficiency. Thus, this model can be used to determine the contribution of host and bacterial factors towards Kpn dissemination.
Introduction
Host-to-host transmission of pathogens is the primary source of nosocomial infections, which are considered a serious threat to patient’s health and also a significant burden on the healthcare system (1, 2). Hospital-acquired infections (HAI) account for ∼100,000 deaths in the United States alone (3). A leading cause of these hospital-acquired infections and multiple outbreaks in hospitals around the world is Klebsiella pneumoniae (K. pneumoniae; Kpn), a member of the Enterobacteriaceae family that frequently causes pneumonia, bacteremia, pyogenic liver abscesses, and urinary tract infections (4), with most of these infections generally occuring in immunocompromised patients. With the rampant use of antibiotics Kpn isolates have become extensively drug-resistant, and some are now even considered pan-drug resistant, making the infections they cause extremely difficult to treat (5-7). For this reason, WHO lists Klebsiella pneumoniae as a critical pathogen for which new antibiotics and other therapies are urgently required to address this growing healthcare problem (8, 9). Further exacerbating treatment of Kpn infections is the recent identification of isolates termed “hypervirulent K. pneumoniae” (hvKP) that can cause disease, such as community-acquired pyogenic liver abscesses in healthy individuals (10-12). Patients recovering from hvKP infections often suffer from post-infectious sequelae that can lead to loss of limb or vision (13-15). These strains, originally isolated in the Pacific Rim, have since disseminated worldwide (10).
In the natural environment, the initial mucosal sites of colonization tend to be the oropharynx and the gastrointestinal (GI) tract (16, 17). These colonization events are generally asymptomatic (18). However, under certain circumstances, Kpn can gain access to other sterile sites in the host and cause disease. Epidemiological data suggest that many patients in hospitals are Kpn carriers in the GI tract, with a correlation between Kpn carriage and subsequent disease from the same isolate (19-21). Besides patients, hospital personnel can also be asymptomatic carriers of Kpn, and these silent carriers act as a reservoir from which Kpn can manifest disease within the same host or act as a source of transmission to a new host (18, 22-24).
Colonization resistance provided by the host microbiota plays a critical role in blocking colonization by pathogens. However, the use of antibiotics diminishes the microbial diversity in the GI tract, which potentially allows Kpn to readily colonize a host. Studies also show that antibiotic treatment of mice predisposes them to a “supershedder” state where they shed resident gut pathogens at a higher number, which enhances host-to-host transmission (25, 26). It is, however, unclear whether antibiotic treatment in a hospital setting contributes towards the increased transmission of drug-resistant Kpn.
Our understanding of the Klebsiella pneumoniae-associated disease-state comes mainly from animal models studying lung and urinary tract infection. While these studies have identified bacterial and host factors that contribute to Kpn virulence, there is very little mechanistic understanding of the gastrointestinal colonization and host-to-host transmission. Close contact, especially in a hospital setting, is thought to promote the spread of Kpn from an infected host to a naïve host. Transmission is thought to occur via the fecal-oral route, either through poor hygiene or contact with contaminated surfaces (fomites) (20, 22-24).
Here, we describe a novel murine model to allow for the study of Kpn GI colonization, shedding, and host-to-host transmission. Employing an oral route of Kpn inoculation in an inbred mouse population, we investigated K. pneumoniae gastric colonization and transmission. We demonstrate that Kpn can stably colonize the GI tract without treatment of antibiotics, and these mice stay persistently colonized and can transmit Kpn to cage-mates. Furthermore, antibiotic treatment of carrier mice induces gut dysbiosis and triggers a transient supershedder phenotype.
Materials and Methods
Ethics Statement
This study was conducted according to the guidelines outlined by National Science Foundation animal welfare requirements and the Public Health Service Policy on Humane Care and Use of Laboratory Animals (27). Wake Forest Baptist Medical Center IACUC oversees the welfare, well-being, and proper care and use of all vertebrate animals. The approved-protocol number for this project is A18-160.
Bacterial growth conditions and strain construction
Strains used in the study are listed in Table 1. K. pneumoniae isolates were grown in Luria-Bertani (LB) Broth Lennox, with constant agitation at 37°C. For all mouse infections, an overnight culture of Kpn was spun down at ∼27000 x g for 15 minutes, and the resulting pellet resuspended in similar volume of 1X Phosphate-Buffered Saline (PBS). To obtain desired density for mouse infections (106 CFU/100µl), the bacterial suspension in PBS was diluted into a 2% sucrose-PBS solution. Ten-fold serial dilutions were plated on selective media (LB-Agar with antibiotic) and incubated at 30°C overnight for quantitative culture. LB plates containing antibiotics were streptomycin (str, 500 µg ml), chloramphenicol (50 µg/ml), ampicillin (25 µg/ml), apramycin (50 µg/ml), spectinomycin (30 µg/ml) and rifampin (30 µg/ml).
The wzi gene codes for a conserved outer membrane protein involved in the attachment of capsular polysaccharide to the outer membrane. Sequence polymorphism in the wzi gene has been used to identify and characterize different isolates. Kpn AZ10 (wzi 372) an antibiotic sensitive isolate was made str-resistant as described, subsequently mouse GI passaged and named AZ99 (28, 29). To construct the fimH mutant in the appropriate genetic background, PCR was carried out using Q5 polymerase (NEB) with AZ101 genomic DNA as template, and primers fimH upstream (GGCGGTGATTAACGTCACCT) and fimH downstream (GATAGAGCAGCGTTTGCCAC), which give at least 500bp homology on either end of the transposon cassette. The PCR product was purified using the Qiagen MinElute kit. Lambda Red mutagenesis was carried out as described previously (30), and cells were recovered in Super Optimal Broth with Catabolite repression (SOC) media at 30°C with shaking overnight. Recovered bacteria were plated on selective LB agar containing chloramphenicol (50 µg/ml). Single colonies were purified and the mutation was confirmed by PCR.
To determine fim promoter orientation, PCR was carried out using either in vitro samples from LB broth, single colonies from LB plates, or in vivo samples (fecal pellets) from mice infected with Kpn. Broth culture was spun down as described above and resuspended in equal volume dH2O and boiled for 5 minutes. Also, a single colony was resuspended in 10 µl of dH2O and boiled for 5 minutes. DNA was isolated from fecal pellets (100 mg) using Quick-DNA™ Fecal/Soil Microbe Microprep (Zymo Research). 5 µl of sample was used in PCR with OneTaq polymerase (NEB) with primers Cas168 GGGACAGATACGCGTTTGAT and Cas169 GCCTAACTGAACGGTTTGA as described previously (31). Purified PCR product was digested with restriction enzyme HinFI (NEB) for 1 hour and resolved on 1.2% agarose gel. As established previously, the “off orientation” of the fim promoter results in product bands of 496bp and 321bp, whereas the “on orientation” results in bands of 605bp and 212bp (31).
Mouse Infections for Colonization and Shedding
Colonies of C57BL/6J (SPF) mice obtained from Jackson Laboratory (Bar Harbor, ME) were bred and maintained in a standard animal facility at Biotech Place, Wake Forest Baptist Medical Center. All animal work was done according to the guidelines provided by the American Association for Laboratory Animal Science (AALAS) {Worlein, 2011 #87} and with the approval of the Wake Forest Baptist Medical Center Institutional Animal Care and Use Committee (IACUC). 5-7 week-old mice were infected and monitored through the course of the experiments. Food was removed from mice ∼6 hours prior to inoculation. Mice were fed ∼106 CFU/100 µl of K. pneumonia in two 50 µl 2% sucrose-PBS doses an hour apart, from a pipette tip. Immediately afterwards, food was returned to mice.
To quantify daily bacterial shedding, mice were removed from their housing and placed into isolation containers. Fecal pellets (∼0.02 g, approximately 2 pellets) were collected and placed into a 2 ml screwcap tube (Fisherbrand, 02-682-558) along with at least 2 glass beads (BioSpec, 11079127). Samples were diluted 1:10 in PBS (weight:volume). A Bead mill 24 (Fisherbrand) was used to homogenize the fecal pellets (2.1 power setting, 1 min). Afterwards, the tubes were spun in a mini centrifuge (Thermo Scientific, MySpin 6) to pellet out larger debris. Ten-fold serial dilutions were plated from the supernatant on appropriate antibiotic plates and incubated overnight at 30°C. Bacterial shedding was calculated in CFUs per gram of feces. The limit of detection was 100 CFU/g. Each mouse was uniquely marked so that the fecal shedding of each individual mouse could be tracked for the duration of the experiment.
To trigger an antibiotic-dependent Kpn supershedder phenotype, mice were infected orally with a str-resistant Kpn as described above. Four to five days post-inoculation (p.i) mice were gavaged with streptomycin (5 mg/200 µl) either once or on three consecutive days, and daily shedding monitored post-antibiotic treatment. To determine effect of neomycin treatment before Kpn infection, mice were gavaged with a single dose (5 mg/200 µl) 24 hours before inoculation with the MKP103 a derivative of KPNIH1 isolate with a deletion of the KPC-3 carbapenemase-encoding gene (32). Bacterial counts were enumerated from fecal pellets as described above. To determine the role of continuous antibiotic treatment on supershedder phenotype, the drinking water was replaced with water containing 1g/L ampicillin 24 hours before infection; mice were maintained on ampicillin-water for 10 day p.i. after which they were placed on regular water until the end of the experiment. Kpn fecal shedding was assessed up to 20 days post-infection, and quantified as described above.
For competition experiments, mice were infected with a 1:1 mixture of AZ94 and the mutant of interest. Fecal shedding of both strains was assessed as described above. Fecal homogenates were plated on both apramycin (50 µg/ml) and str (500 ug/ml) LB agar. The competitive index (CI) was calculated as described previously (33), using the following equation:
A value of 0 would suggest that neither strain has an advantage. A value >1 would suggest that the mutant has competitive advantage, whereas a value <1 would indicate the WT has the advantage.
To determine colonization density in the GI tract, ileum, cecum, and colon were removed under sterile conditions immediately following CO2 (2 liters/min, 5 min) euthanasia of animals and subsequent cardiac puncture. The cecum, proximal colon, and a span of the terminal section of the ileum equal in length to the colon were removed from each animal. Organs were weighed and placed into individual 2 ml screwcap tubes (Fisherbrand, 02-682-558) with at least 2 glass beads (BioSpec Products, 11079127). Samples were diluted 1:10 in PBS (weight:volume) and were homogenized and plated as described above. The limit of detection was 100 CFU/g.
To determine colonization density in the kidney, liver and spleen, organs were removed under sterile conditions immediately following euthanasia as described above. Organs were weighed and placed 15 ml conical tubes. For kidney and liver equal weight to volume PBS was added, and samples were homogenized using PowerGen 700 (Power setting 2 for 30 seconds), whereas for spleen, ten times the volume of 1X PBS was added to the weight of the organ and homogenized as above. The samples were plated as described. The limit of detection of kidney and liver was 33 CFU/ml and for spleen 100 CFU/ml.
Oropharyngeal lavage was carried out with 200 µl of sterile PBS from a gavage needle inserted into the esophagus. The esophagus was exposed and cut transversely. A gavage needle, attached to a prefilled insulin syringe (BD) with 1X PBS was then inserted into the cut esophagus, and PBS collected from the mouth. The collected lavage was serially diluted and plated on appropriate antibiotic plates and incubated overnight at 30°C. The limit of detection for oral lavage was 33 CFU/ml.
Transmission Studies
For 4:1 and 1:4 transmission experiments C57BL/6J index mice (n=1 or n=4) at 5-7 weeks of age are infected with Kpn as described above, and shedding is collected daily to determine colonization density of the GI tract. On day 4 p.i., contact mice (n=4 or n=1) were introduced to cages with the index mice. Fecal shedding of index and contact mice was collected and quantified for at least 6 days post-cohousing, for a total of 10 days for index mice and 6 days for contact mice. On day 10, the mice were euthanized as described above and the ileum, cecum, colon, and oral lavages of all mice were processed as described above to determine colonization density of Kpn.
In 1:4 transmission experiments, in which the administration of a single dose of antibiotic was assessed, index mice were infected with a str-resistant Kpn and fecal shedding of Kpn was quantified for 4 days p.i. On day 5 p.i, index mice were treated with streptomycin (5 mg/200 µl) via gavage and then co-housed with contact mice. Fecal shedding was collected daily from index and contact mice. In a continuous antibiotic challenge transmission study, an index mouse was put on water containing ampicillin (1 g/L) 24 hours before infection. The contact mice were placed on water containing ampicillin (1 g/L) 24 hours before introduction of the index mouse. Once co-housed, daily shedding was collected from both index and contact mice to determine if any transmission events occurred.
To confirm that host-to-host transmission events occur through the fecal oral route, a metabolic cage (Tecniplast Cat. # 3700M022) was used. Kpn infections were carried out as described above. 4 days post-infection, a contact mouse was introduced into the metabolic cage and fecal shedding collected from both index and contact mice to determine transmission frequency.
Histology
Mice were infected with either PBS (vehicle-only control) or a KPPR1S isolate. A subset of Kpn-infected mice were gavaged with streptomycin (single treatment; 5 mg/200 µl) to induce the super-shedder state at 5 days p.i. As a positive control, mice were put on 3% w/v Dextran Sodium Sulfate (DSS) molecular weight 50,000 in their drinking water ad libitum for 7 days. All the mice were euthanized at day 7 post initial treatment or infection. 2.5 cm of colon immediately distal to the cecum was collected, washed with 1x PBS, and prepared using the Swiss roll method. Afterwards the sample was preserved in 1:10 Formalin (Fisherbrand, 305-510), and after 24 hours transferred to 70% ethanol. The samples were embedded in paraffin before being sectioned, mounted, and stained with hematoxylin and eosin (H & E). The resulting slides were scored by the Wake Forest Baptist Medical Center Pathology department.
Liver was collected under sterile conditions from either mock infected mice or from orally infected mice with hvKP1, and in extremis. Liver samples were cut in to sections about 6.5mm, and placed in 10% formalin (10 parts formalin to 1 part tissue). After 24-48 hours the samples were transferred to 70% Ethanol and stored at 4°C till they were further processed for H & E and Gram staining, with scoring carried out as described above.
Fecal microbiome Analysis
Fecal microbiome was examined according to previously described methods (34-36). Briefly, genomic DNA from 200 mg feces was extracted using MoBio Powerfecal DNA kit (Qiagen, Valencia, CA) per manufacturer’s instructions. Amplicon PCR of the V4 hypervariable region of the 16S rDNA gene was performed using the universal primers 515F (barcoded) and 806R according to the Earth Microbiome Project protocol (PMID: 22402401). The amplicons were purified using AMPure® magnetic beads (Agencourt), and the products quantified with Qubit-3 fluorimeter (InVitrogen). The final amplicon library was generated as previously described (37). Equimolar pooled library was sequenced on an Illumina MiSeq platform using 2×300bp reagent kit (Miseq reagent kit v3; Illumina Inc.) for paired-end sequencing. The sequencing quality control was done with on-board Miseq Control Software and Miseq Reporter (Illumina Inc.) and the obtained sequences were de-multiplexed, quality-filtered, clustered and analyzed using QIIME software package (34, 35, 38, 39). Taxonomy classification was performed within QIIME based on 97% sequence similarity to the Greengenes database (38). Alpha-diversity and bacterial proportions were compared using Kruskal-Wallis test followed by pair-wise Mann-Whitney test. Linear discriminatory analysis (LDA) effect size (LEfSe) was applied to identify discriminative features (unique bacterial taxa) that drive differences at different time-points or in different groups (40). Hierarchical clustering and heat-maps depicting the patterns of abundance were constructed within ‘R’ statistical software package (version 3.6.0; https://www.r-project.org/) using the ‘heatmap.2’ and “ggplots” packages.
Statistical analysis
All statistical analyses were performed using GraphPad Prism 8.0 (GraphPad Software, Inc., San Diego, CA). Unless otherwise specified, differences were determined using the Mann-Whitney U test (comparing two groups) or the Kruskal-Wallis test with Dunn’s post-analysis (comparing multiple groups).
Results
Establishing Klebsiella pneumoniae colonization in the murine intestinal tract
We sought to establish a GI model of Klebsiella pneumoniae colonization that would mimic natural colonization in a host. Because of the difficulty in establishing Kpn GI colonization through gavage treatment, previous studies used antibiotic pre-treatment to disrupt the host microbiota and allow for Kpn colonization via the gavage method (41-43). We first tested the ability of Kpn to colonize the GI tract by giving adult mice doses ranging from 105-109 CFU/100µl, without antibiotic treatment so as not to disrupt the host microbiota (Fig. 1A). However instead of a gavage treatment, mice were infected orally by pipette feeding to simulate the natural route of infection (44). We used a Kpn clinical isolate KPPR1S that has been used extensively to model Kpn-associated disease-state in mice. The streptomycin- and rifampin-resistance of KPPR1S allowed us to enumerate the bacteria in the fecal pellets on selective plates. As observed in Fig. 1B-C, Kpn colonized the GI tract and was shed robustly in the feces of mice with doses above 105 CFU. A dose < 105 CFU did not result in the establishment of colonization (Threshold for detection 100 CFU), suggesting a minimum dose of 105 is required (Data not shown). Based upon these results, we chose 106 CFU, as the minimum dose required to establish Kpn colonization. Based on our preliminary studies that suggest poor Kpn fecal shedding correlates with reduced GI colonization, we used daily fecal shedding as a substitute for colonization density in the GI tract. Next, we determined how long Kpn colonizes the mouse GI tract. We followed Kpn shedding in feces of infected mice for either 15 or 30 days p.i and observed that Kpn was shed at similar levels throughout the study (Fig. 1D-E). Furthermore, our results showed that Kpn colonizes the mucosal surface of the oropharynx (Fig. 1F). Taken together, our data suggest that, when introduced by the oral route, Kpn colonizes the mucosal surface of the oropharynx, can establish and persist in the GI tract, and is shed robustly in the feces.
A hallmark of K. pneumoniae isolates is their genetic heterogeneity, which affects their ability in causing disease (45). Thus, we determined whether Kpn genetic plasticity also contributes to GI colonization. We tested the ability of a set of genetically diverse clinical Kpn isolates to colonize the GI tract of mice. For analysis we chose MKP103 a derivative of KPNIH1, which was the cause of an outbreak at NIH Clinical Center, hvKP1, a hypervirulent human isolate, and AZ99, a human fecal isolate. All three strains showed varying colonization density of the murine GI tract, with the hvKP1 shedding at a similar level to KPPR1S (Fig. 2A). Surprisingly, the MKP103 isolate colonized poorly, with mice generally clearing it from their GI tract by day 5 p.i. As observed through fecal shedding, the human fecal isolate AZ99 consistently colonized the GI tract albeit at a lower density in comparison to KPPR1S. Moreover, mice colonized with hvKP1 had a high mortality rate (Fig. 2C). Hypervirulent isolates are notorious for causing pyogenic liver abscesses (PLA) (11). As shown in Fig. 2D mice that succumbed after oral inoculation with the hvKP1 isolate, were colonized at a high density in the liver, kidney and spleen with the same isolate. Moreover, these mice appeared to have developed liver abscesses (Fig. 3A), which H&E and Gram staining confirmed to contain necrotic tissue, inflammatory cells, and gram negative bacteria (Fig. 3B-D). Thus, our model mimics human disease dynamics, where a hypervirulent isolate (hvKP1) is able to translocate from the GI tract to other sterile sites, and cause the development of the disease state.
Antibiotic treatment leads to the development of the Kpn supershedder phenotype
Given that the fecal-oral route of transmission in a hospital setting is considered a significant cause of nosocomial infections (46, 47) it was surprising that the MKP103 isolate failed to colonize the GI tract of mice (Fig. 2A). However, as many of the patients that acquired MKP103 in the GI tract were on antibiotics (20), we considered whether the use of antibiotics would affect the ability of this isolate to colonize the GI tract. Moreover, high use of antibiotics in a health-care setting correlates with Klebsiella pneumoniae infections (20). Therefore mice were gavaged with neomycin to reduce the colonization resistance by the host GI microbiota, and then infected with MKP103 to determine whether antibiotic treatment positively affected its ability to colonize. As shown in Fig. 2B antibiotic pre-treatment of mice allowed MKP103 to colonize and persist within the infected host GI tract up to 15 days post-infection.
Our results show that antibiotic treatment allows Kpn isolate (MKP103) that colonizes poorly to establish itself in the GI tract. However, whether antibiotic treatment affects colonization density of isolates that colonize robustly without requiring antibiotic treatment remains unknown. We determined whether treatment with antibiotics would lead to the development of a supershedder phenotype, in which an infected host sheds the pathogen at a much higher number than other infected host. This phenomenon has been observed in the natural setting and is considered a major source of host-to-host transmission (48). Murine models have been used to characterize this phenotype, where >108 CFU/g (supershedder [SS] threshold) of the indicated pathogen in the feces is generally considered as the threshold for the supershedder phenotype (SS phenotype) (25, 26). Using the KPPR1S isolate, as it consistently colonized mice at a high density without antibiotic treatment, we assessed fecal shedding of Kpn for 10-12 days p.i. after either a single streptomycin treatment or three consecutive days of streptomycin treatment. We found that antibiotic treatment triggered a temporary supershedder phenotype (Fig. 4A-B), whereas, no such phenotype was observed with the vehicle only control (PBS) (Fig. S1A). A second treatment of antibiotics, after mice had returned to baseline levels of Kpn shedding from the first antibiotic treatment, caused the development of another transient supershedder phenotype (Fig. S1B).
In a clinical setting, immunocompromised patients tend to be on continuous antibiotic treatment; therefore, we determined the effect of daily antibiotic treatment on Kpn shedding. We supplemented the drinking water of mice with ampicillin 24 hours before Kpn inoculation and continued for 10 days p.i. As Kpn is intrinsically resistant to ampicillin, the mice infected with MKP103 isolate displayed the Kpn supershedder phenotype (Fig. 4C). After removal of antibiotic pressure, the mice displayed the high shedding phenotype for multiple days. Taken together, our data suggest that, as a consequence of antibiotic treatment, Kpn can develop a supershedder phenotype and the length of this phenotype is dependent upon the duration of the antibiotic treatment.
Antibiotic treatment leads to the disruption of host-microbiota that correlates with the supershedder phenotype
Next, we determined whether Kpn infection or antibiotic treatment induced supershedder phenotype is a result of the displacement of the host microbiota. To provide insight into the Kpn carrier state and the supershedder phenotype, we carried out a 16S analysis to determine the host intestinal microbiota changes that occurred during infection and as a consequence of antibiotic treatment (Fig. 5A). For a detailed 16S analysis, we isolated DNA from fecal samples collected at six different time points from Kpn infected mice (n=4). Fecal pellets were collected pre-inoculation to determine the baseline of the host GI microbiota. Samples were collected on days 7, 9 and 11 post-antibiotic treatment to determine changes in the host microbiota. At days 3 and 5 p.i, we were unable to detect Kpn 16S rRNA gene sequences, even though it shed at 106 CFU / Gram of fecal sample. This result suggests that Kpn comprises only a minor component of the host intestinal microbiota. The main component of a diverse microbial community of the host intestine included Bacteroidetes (Bacteroidales [S24-7]) and Firmicutes (Clostridales) (Fig. 5C; Table. S1), which are considered to be a typical profile for stable mammalian intestinal microbiota.
A single treatment with str led to dramatic changes in the intestinal microbiota. As detailed in Fig. 5B, there was a statistically significant decline in the total species richness, especially in S24-7, with a concurrent increase in Erwinia and Bacteroides. As illustrated in Fig. 5C, we only observed Kpn-specific 16s rRNA gene sequences during the antibiotic-induced supershedder phenotype. A decrease in Kpn shedding levels correlated with an increase in S24-7 and other major components of the host microbiota, and a loss of detection of Kpn specific 16s rRNA sequences. Thus, antibiotic treatment leads to a disruption of host-microbiota that correlates with the development of temporary supershedder phenotype. Moreover, disruption of the host microbiota with antibiotics is associated with reduced microbial richness, which recovers three days post-antibiotic exposure.
Klebsiella pneumoniae factors contributing to shedding and colonization
To examine the contribution of known virulence determinants of Kpn, we tested shedding and colonization of the previously described capsule (cps)-deficient mutant (ΔmanC) of the strain KPPR1S. As is evident from Fig. 6A, over the course of 15 days of infection, the ΔmanC mutant shed and also colonized poorly (Fig. S2) in comparison to the parental wild-type (WT) strain.
Bacteria can form biofilm like structures in the GI tract (49). We hypothesized that a coinfection with WT Kpn and the ΔmanC strain would form a mixed population (intraspecies) biofilm in the GI tract, helping compensate for the capsule deficiency of the ΔmanC strain. However, coinfected mice still shed the ΔmanC strain poorly compared to the parental strain (Fig. 6B). These observations suggest that capsular polysaccharide of Kpn is essential for robust GI colonization and eventual fecal shedding.
Next, as the type 1 fimbriae of Kpn is considered essential for colonization of the host urinary tract, we determined its role in GI colonization (31). The KPPR1S fim locus promoter is under phase variable control, which was observed to be in the off position under both in vitro (broth culture) and in vivo (fecal pellets) (data not shown). To determine the requirement of type 1 fimbriae of KPPR1S in GI colonization, a deletion mutant of fimH that encodes the type 1 fimbriae tip adhesin, required for proper interaction with the host epithelial layer (50) was constructed. As is evident from Fig. 6C-D, even though mice infected with the fimH-mutant had reduced median shedding, it was not significantly lower than the WT strain. Lastly, we determined whether these mutants also contribute towards colonization of the mucosal surface of the oropharynx. Fig. 6E shows, capsule was essential for colonization of the oropharyngeal space, whereas type 1 fimbriae was dispensable. Overall our data indicate that Kpn capsular polysaccharide plays a critical role in GI colonization. In contrast, Kpn type1 fimbriae appears to be nonessential for gut colonization.
Klebsiella pneumoniae transmission occurs through the fecal-oral route
Transmission of enteric pathogens generally occurs through the fecal-oral route, and host-to-host transmission in a hospital setting is a major source of infection (20, 46). Thus, we determined whether Kpn host-to-host transmission events could be observed in our animal model. Initially, we housed one uninfected mouse (contact) with four infected mice (index). Fecal pellets were collected to enumerate colonization density and whether transmission from index to contact mice occurred. We observed 100% transmission efficiency with a ratio of 4:1, with transmission occurring within 24 hours of cohousing the animals (Fig. 7A and C). Since transmission efficiency is high with a ratio of 4:1, we decided to determine Kpn transmission dynamics with one index mouse cohoused with four contact mice. With a ratio of 1:4 reduced transmission efficiency (∼35%) was observed, suggesting that not enough Kpn shedding events occurred for all uninfected mice to become colonized (Fig. 7B-C).
Next, to mimic conditions prevalent in a hospital, where patients tend to be on antibiotics, we investigated the effects of antibiotic treatment on Kpn transmission dynamics. A single antibiotic treatment to the index mouse cohoused with four contact mouse led to >90% transmission, suggesting that high Kpn shedding in the fecal pellets can overcome colonization resistance of the contact mice (Fig. 7C). Lastly, we tested the effect of antibiotics on both index and contact mice by adding antibiotics in their drinking water. An index mouse was infected with MKP103 and was housed separately for several days before being introduced to four contact mice already on antibiotics. We observed 100% transmission efficiency when both index and contact mice were on daily antibiotics. Moreover, as all the mice in the cage were on antibiotics, they all developed the supershedder phenotype (Fig. S3A). Our results provide insight into the high transmissibility of Kpn in hospitals where there is high antibiotic usage.
We hypothesize that Kpn transmission occurs through the fecal-oral route, based upon transmission models of other enteric pathogens and the coprophagic nature of mice. However, as Kpn colonizes both the oral cavity and the GI tract, we determined whether host-to-host transmission of Kpn is due to the coprophagic action of mice or by contact with infected oral secretions. Mice were housed in a metabolic cage, where they do not have access to their fecal pellets. At a 4:1 ratio of the index to contact mice, no transmission events were detected between the infected and the uninfected mice during the 10-day experiment, suggesting that in our animal model, host-to-host transmission requires the contact with fecal matter (Fig. 7C). Lastly, the infected mice in the metabolic cage shed Kpn robustly suggesting persistent colonization that did not require re-seeding through the consumption of infected fecal pellets (Fig. S3B).
Discussion
The genetic heterogeneity of Klebsiella pneumoniae allows this pathogen to colonize a variety of host mucosal surfaces, which can dramatically impact the clinical outcome. Klebsiella pneumoniae disease manifestations in the respiratory and urinary tract have been extensively modeled in animals (4). However, the gastrointestinal mucosal surface, also colonized readily by Kpn has not been the focus of many scientific studies (51, 52). In this report, we describe a murine model of oral infection of K. pneumoniae to study GI colonization and host-to-host transmission. We demonstrate for the first time that Kpn can stably colonize the GI tract of immunocompetent mice without disrupting the host-microbiota – a key strength of our model. Secondly, a host colonized persistently with a pathogen is considered a significant reservoir for new infections, and our animal model of Kpn GI colonization replicates this phenotype, indicating it is a useful tool to study within-host events and host-to-host transmission. Third, we observed variability in the ability to colonize the GI tract and to cause invasive disease between different Kpn isolates, suggesting Kpn genetic plasticity might be involved in the observed variability. Lastly, as many patients in a hospital setting tend to be on antibiotics, we were able to show experimentally for the first time that antibiotic treatment triggers the development of the supershedder phenotype in carrier mice, which promotes host-to-host transmission.
Previous studies used antibiotic treatment to reduce host colonization resistance by disrupting the resident microbiota to establish Kpn colonization (31, 41, 53). However, treatment with antibiotics reduces the ability to discern the role of bacterial factors that allow Kpn to overcome colonization resistance. Our model does not require the use of antibiotics to establish stable and persistent Kpn colonization, and therefore allows for the identification of bacterial and host factors that contribute to Kpn colonization and transmission. In our initial studies, we established that the route of infection is critical for stable colonization of Kpn in the GI tract. Oral gavage, a standard mode of infection for modeling enteric infections in murine models, only led to transient Kpn colonization in the GI tract (data not shown). However, by orally feeding a similar dose allowed Kpn to colonize the GI tract and persist without disrupting the host microbiota. A recent study by Atarashi et al. showed that Kpn colonizing the oral cavity of patients can seed the GI tract (44). In our model of infection we also observed Kpn colonizing the murine oral cavity.
A hallmark of many GI pathogens is their ability to cause an acute host inflammatory response. Multiple reports also suggest that Kpn might contribute towards gut dysbiosis and play an active role in inducing host response (44, 54). However, epidemiological data also suggest that Kpn can silently colonize healthy individuals (18). In our murine model, we were unable to detect any acute signs of inflammation post-Kpn infection. Furthermore, unlike the Salmonella serovar Typhimurium supershedder phenotype, the Kpn antibiotic-induced supershedder phenotype was not associated with colitis (Fig. S4). Our data suggest that Kpn in the GI tract behaves in a manner that does not elicit an acute inflammatory response and carriage is considered an asymptomatic event.
The role of major virulence factors of Kpn, including its capsular polysaccharide (CPS), type 1 fimbriae, and others have been extensively examined under both in vitro and in vivo conditions (4). However, data for the requirement of Kpn CPS in GI colonization appears contradictory (41, 42). As those studies were undertaken in mice treated with antibiotics, it is possible that the exact role of the bacterial factors is probably masked. Herein, using our model, we show definitively that CPS of Kpn is an essential component required for efficient colonization of both the upper (oropharynx) and lower (intestinal) GI tract. The role of the capsule possibly pertains to protection against host-mediated clearance and interactions with mucus (42, 55, 56).
We also tested the requirement of the Kpn type 1 fimbriae in GI colonization. Even though the type 1 fimbriae is critical for colonization of the urinary tract, it appears to be dispensable for GI colonization (31). However, with certain pathogenic E. coli isolates, type 1 fimbriae is required for colonization (57, 58). Furthermore, recent work by Jung et al. using antibiotic-treated mice observed a defect in GI colonization with a Kpn fimD mutant that is missing the usher constituent that facilitates assembly and eventual translocation of the pilus across the outer membrane (53). However, in our model we only observed a slight reduction in median shedding from mice infected with the fimH isogenic mutant compared to the WT strain, suggesting that the expression of the type 1 fimbriae of the KPPR1S isolate is dispensable for GI colonization. This result that the type 1 fimbriae of KPPR1S isolate does not contribute towards GI colonization was not unexpected, as we did not observe its expression under the conditions tested (Data not shown). However, type 1 fimbriae might play a role in GI colonization for isolates that do express the structure.
Our model also allows us, for the first time, to understand the transmission dynamics of Klebsiella pneumoniae. We observed transmission events between Kpn-infected and contact mice, suggesting that Kpn shedding in this model is high enough to permit transmission, albeit at a lower frequency. We also observed that the contact mice colonized at a lower density compared to the index mice, possibly because of the reduced Kpn dose in the fecal pellets. Thus, our data follows epidemiologic studies that suggest 5-25% carriage rates in the natural environment (19, 59). However, the treatment of either infected or contact mice with antibiotics led to a high host-to-host transmission frequency. A single dose of antibiotic treatment established a suppershedder phenotype in the index host, which was able to transmit to >90% of uninfected mice. It is suggested that 80% of the infections are due to 20% of infected individuals transmitting to uninfected hosts (known as the 80/20 rule) (60). Such individuals are termed as supershedders or superspreaders. However, we were unable to observe a Kpn supershedder phenotype without disrupting the host microbiota, suggesting that in our animal model, Kpn transmission dynamics do not follow the 80//20 rule. Multiple studies on enteric pathogens show that antibiotic treatment causes a dysbiosis in the GI tract, reduces colonization resistance by the stable resident microbiota, and promotes the expansion of pathogens (25, 26). Our 16S analysis shows that the antibiotic-based supershedder phenotype correlates with a reduction in microbial diversity. In contrast to Salmonella serovar Typhimurium and Clostridium difficile supershedder phenotypes (25, 26), the Kpn supershedder phenotype lasts for a shorter duration following a single antibiotic treatment. However, Kpn infected mice on continuous antibiotics shed at supershedder levels, a condition we believe to be common in a hospital setting. Our data suggest that the development of the supershedder phenotype is the main contributor to host-to-host transmission events in a hospital. The transmission frequency of K. pneumoniae has not been established in a hospital setting and may be higher or lower than the rates determined in our murine model. We believe that a setting with high antibiotic use increases the likelihood of Kpn outbreaks. Therefore, patients on antibiotics should be carefully monitored to determine if they are colonized with K. pneumoniae.
In conclusion, we have described a model that will be useful in understanding complex interactions between K. pneumoniae and the host immune system and the intestinal microbiota. The availability of an arrayed marked mutant library of Kpn (32) and several annotated Kpn genomes should allow for studies identifying bacterial factors that contribute towards Kpn colonization and transmission. Since a majority of Kpn nosocomial infections arise from GI colonization and fecal-oral route of transmission (20, 29), an understanding of the biology of Kpn gastrointestinal colonization and fecal-oral transmission would be valuable as it could serve as an ideal point of intervention.
Supplemental Figures
Acknowledgements
We would like to thank Drs. Michael Bachman (University of Michigan), Alan Hauser (Northwestern University), Virginia Miller (UNC Chapel Hill), Thomas Russo (University of Buffalo-SUNY) and Jeffery N. Weiser (NYU School of Medicine) for the strains used in this study. We would also like to thank Drs. Phillip Hernandez (Boston University), Virginia Miller, Kimberly Walker (UNC Chapel Hill), Jeffrey N. Weiser and Tonia Zangari (NYU School of Medicine) for fruitful discussions in regards to the establishment of the model and the manuscript.
This study was funded by startup funds provided by Wake Forest Baptist Medical Center to M.A.Z.