First paragraph
Dodders (Cuscuta spp.) are obligate parasitic plants that obtain water and nutrients from the stems of host plants via specialized feeding structures called haustoria. Dodder haustoria facilitate bi-directional movement of viruses, proteins, and mRNAs between host and parasite1, but the functional effects of these movements are not clear. Here we show that C. campestris haustoria accumulate high levels of many novel microRNAs (miRNAs) while parasitizing Arabidopsis thaliana hosts. Many of these miRNAs are 22 nts long, a usually rare size of plant miRNA associated with amplification of target silencing through secondary small interfering RNA (siRNA) production2. Several A. thaliana mRNAs are targeted by C. campestris 22 nt miRNAs during parasitism, resulting in mRNA cleavage, secondary siRNA production, and decreased mRNA accumulation levels. Hosts with mutations in two of the targets supported significantly higher growth of C. campestris. Homologs of target mRNAs from diverse plants also have predicted target sites to induced C. campestris miRNAs, and the same miRNAs are expressed and active against host targets when C. campestris parasitizes a different host, Nicotiana benthamiana. These data show that C. campestris miRNAs act as trans-species regulators of host gene expression, and suggest that they may act as virulence factors during parasitism.
Host-induced gene silencing (HIGS) involves plant transgenes that produce siRNAs which can silence targeted pathogen/parasite mRNAs in trans3,4. Plant-based HIGS is effective against fungi5, nematodes6, insects7, and the parasitic plant Cuscuta pentagona8. The apparent ease of engineering HIGS suggests that plants might exchange naturally occurring small RNAs during pathogen/parasite interactions. Consistent with this hypothesis, small RNAs from the plant pathogenic fungus Botrytis cinerea target host mRNAs during infection9, and HIGS targeting B. cinerea Dicer-Like mRNAs reduces pathogen virulence10. Conversely, the conserved miRNAs miR159 and miR166 can be exported from cotton into the fungal pathogen Verticillium dahliae where they target fungal mRNAs encoding virulence factors11. However, to date, no examples of naturally occurring trans-species miRNAs have been described for plant-to-plant interactions.
Cuscuta haustoria facilitate bi-directional movement of viruses, proteins, and mRNAs1, but the functional effects of these movements are unclear. Cuscuta is susceptible to HIGS, so we hypothesized that naturally occurring small RNAs might be exchanged across the C. campestris haustorium and affect gene expression in the recipient species. To test this hypothesis, we profiled small RNA expression from C. campestris grown on A. thaliana hosts using high-throughput small RNA sequencing (sRNA-seq). Two biological replicates each from three tissues were analyzed: Parasite stem (PS), comprising a section of C. campestris stem above the site of haustorium formation; Interface (I), comprising C. campestris stem with haustoria with associated A. thaliana stem tissue; and Host stem (HS), comprising sections of A. thaliana stems above the interface region, as previously described12. Small RNA-producing loci from both organisms were identified, classified, and subject to differential expression analyses (Supplementary Data 1).
As expected due to dilution of parasite RNA with host RNA, C. campestris small RNA loci were generally down-regulated in I relative to PS (Figure 1A). However, 76 C. campestris small RNA loci were significantly (FDR <= 0.05) higher in I relative to PS. 43 of these (57%) were MIRNA loci as determined by canonical accumulation of a discrete miRNA/miRNA* pair from predicted stem-loop precursors (Figure 1B, Supplementary Data 2-4). RNA blots confirmed I-specific expression (Figure 1C). One of the 43 MIRNAs is a member of the conserved MIR164 family; the other 42 up-regulated MIRNAs have no obvious sequence similarity to previously annotated MIRNA loci, and none of their mature miRNAs or miRNA*s were perfectly alignable to the A. thaliana genome (Supplementary Data 5). Several of the key MIRNA loci were detected by PCR of C. campestris genomic DNA prepared from four-day old seedlings that had never interacted with a host plant (Extended Data Figure 1). The majority of the induced C. campestris MIRNA loci (26/43) produced a 22 nt mature miRNA. 22 nt plant miRNAs are usually less frequent than 21nt miRNAs, and they are strongly associated with secondary siRNA accumulation from their targets13,14. Secondary siRNAs are thought to amplify the strength of miRNA-directed gene silencing2.
We hypothesized that the induced 22 nt miRNAs would cause secondary siRNA formation from targeted host mRNAs. Therefore we searched for A. thaliana mRNAs that had one or more plausible miRNA complementary sites and accumulation of secondary siRNAs specifically in the I small RNA-seq samples. Six A. thaliana mRNAs that met both criteria were found: TIR1, AFB2, and AFB3, which encode related and partially redundant auxin receptors15, BIK1, which encodes a plasma membrane-localized kinase required for both pathogen-induced and developmental signaling16,17, SEOR1, which encodes a major phloem protein that accumulates in filamentous networks in sieve tube elements and reduces photosynthate loss from the phloem upon injury18,19, and SCZ/HSFB4, which encodes a predicted transcriptional repressor that is required for the formation of ground tissue stem cells in roots20-22. The induced siRNAs from these mRNAs resembled other examples of secondary siRNAs in their size distributions, double-stranded accumulation, and phasing (Figure 2A-B; Extended Data Figure 2). TIR1, AFB2, and AFB3, are also known to be targeted by the 22 nt miR393 and to produce secondary siRNAs downstream of the miR393 complementary site23. In parasitized stems the location and phase register of the TIR1, AFB2, and AFB3 secondary siRNAs shift upstream, proximal to the complementary sites to the C. campestris miRNAs (Extended Data Figure 2), implying that the C. campestris miRNAs, not miR393, are triggering the I-specific secondary siRNAs. The predominant 21 nt phase register at several loci was shifted +1 to +2 relative to the predictions. This is consistent with the 'phase drift' seen at other phased siRNA loci24,25 and likely due to the presence of low levels of 22nt siRNAs, causing the register to be shifted forward. Analysis of uncapped mRNA fragments using 5'-RNA ligase-mediated rapid amplification of cDNA ends found strong evidence for miRNA-directed cleavage at all of the complementary sites to C. campestris miRNAs, specifically from interface samples but not from control stem samples (Figure 2; Extended Data Figure 2). We did not find any induced miRNAs or siRNAs from the A. thaliana host capable of targeting these six mRNAs. We also did not find any endogenous C. campestris secondary siRNA loci corresponding to any of the induced miRNAs. Some C. campestris orthologs of TIR/AFB, SCZ/HSFB4, and BIK1 had possible, but very poorly complementary, miRNA target sites (Extended Data Figure 3). These observations suggest that the induced C. campestris miRNAs have evolved to avoid targeting ‘self’ transcripts. We conclude that 22 nt miRNAs from C. campestris act in a trans-species manner to target A. thaliana mRNAs.
Accumulation of five of the six secondary siRNA-producing targets was significantly reduced in stems parasitized by C. campestris compared to un-parasitized stems (Figure 3A), consistent with miRNA-mediated repression. The true magnitude of repression for these targets could be even greater, since many miRNAs also direct translational repression. Accumulation of many known A. thaliana secondary siRNAs is often partially dependent on the endonuclease Dicer-Like 4 (DCL4) and wholly dependent on RNA-Dependent RNA polymerase 6 (RDR6/SGS2/SDE1)2. Accumulation of an abundant secondary siRNA from TIR1 was eliminated entirely in the sgs2-1 mutant, and reduced in the dcl4-2t mutant (Figure 3B). Thus host DCL4 and RDR6/SGS2/SDE1 are required for secondary siRNA production. This implies that the C. campestris derived miRNAs are active inside of host cells and hijack the host’s own silencing machinery to produce secondary siRNAs.
In repeated trials with varying methodologies we did not observe consistent significant differences in parasite fresh weight using dcl4-2t and sgs2-1 mutants as hosts (Extended Data Figure 4). Thus, loss of induced secondary siRNAs is not sufficient to detectably affect parasite biomass accumulation in this assay. Similarly, there were no significant differences in parasite fresh weights when scz2 or tir1-1/afb2-3 plants were used as hosts (Figure 3C). Significantly less C. campestris biomass was observed using bik1 mutants as hosts. However, interpretation of this result is complicated by the weak, frequently lodging stems of the bik1 mutant16. Significantly more C. campestris biomass was observed when grown on seor1 or afb3-4 mutant hosts (Figure 3C). Therefore, both SEOR1 and AFB3 function to restrict C. campestris growth on A. thaliana. This observation is consistent with the hypothesis that both SEOR1 and AFB2 are trans-species miRNA targets of biological relevance.
C. campestris has a broad host range among eudicots26. Therefore, we searched for miRNA complementary sites for the interface-induced C. campestris miRNAs in eudicot orthologs of the targeted A. thaliana mRNAs. Probable orthologs of BIK1, SEOR1, TIR/AFB, and SCZ/HSFB4 were predicted targets of interface-induced miRNAs in many eudicot species, while only one species had predicted targets for the negative control orthologs of GAPDH (Figure 4A, Extended Data Table 1). We conclude that the induced C. campestris miRNAs collectively would be able to target TIR/AFB, SEOR1, SCZ/HSFB4, and BIK1 orthologs in many eudicot species.
We performed additional small RNA-seq from C. campestris on A. thaliana hosts, and from C. campestris on Nicotiana benthamiana hosts. Both sets of experiments were designed identically to the original small RNA-seq study (two biological replicates each of HS, I, and PS samples). The I-induced set of C. campestris MIRNA loci was highly reproducible across both of the A. thaliana experiments as well as the N. benthamiana experiment (Extended Data Figure 5). Induction of several C. campestris miRNAs during N. benthamiana parasitism was confirmed by RNA blots (Figure 4B). Several N. benthamiana mRNAs had both plausible target sites for C. campestris miRNAs and accumulation of phased, secondary siRNAs in the I samples, including orthologs of TIR/AFB and BIK1 (Extended Data Figure 6). Analysis of uncapped RNA ends provided strong evidence for miRNA-directed cleavage of one of the N. benthamiana TIR1/AFB orthologs (Figures 4C-D; Extended Data Figure 7). This directly demonstrates that the same C. campestris miRNAs target orthologous host mRNAs in multiple species. None of the interface-induced miRNAs we tested were detectable from C. campestris pre-haustoria sampled from seedling tips that had coiled around dead bamboo stakes instead of a live host (Figure 4B; Extended Data Figure 8). This suggests that expression of these miRNAs requires prior contact with a living host.
These data demonstrate that C. campestris induces a large number of miRNAs at the haustorium, and that some of them target host mRNAs and reduce their accumulation. Many of the induced miRNAs are 22 nts long, and associated with secondary siRNA production from their host targets using the host’s own secondary siRNA machinery. Several of the targets are linked to plant pathogenesis: Manipulation of TIR1/AFB2/AFB3 accumulation levels affects bacterial pathogenesis and defense signaling27, and BIK1 is a central regulator of pathogen-induced signaling28. Perhaps the most intriguing target is SEOR1, which encodes a very abundant protein present in large agglomerations in phloem sieve-tube elements18. seor1 mutants have an increased loss of sugars from detached leaves19, and our data show that seor1 mutants also support increased C. campestris biomass accumulation. A key function of the haustorium is to take nutrients from the host phloem; targeting SEOR1 could be a strategy to increase sugar uptake from host phloem. Overall, these data suggest that C. campestris trans-species miRNAs might function as virulence factors to remodel host gene expression to its advantage during parasitism.
Methods [separate online only document].
Author Contributions
SS and MJA performed most bioinformatics analysis. SS, MJA, and NRJ prepared figures and tables. GK and JHW cultivated and harvested plant specimens used for initial small RNA-seq experiments. NRJ, SS, TP, and MJA cultivated and harvested plant specimens for other experiments. EW, GK, CWD, and JHW performed genome and transcriptome sequencing and preliminary assemblies. FW, SS, and NRJ performed RNA blots. SS and MJA performed 5'-RLM-RACE and qRT-PCR. CC and TP constructed small RNA-seq libraries. NRJ and VB-G performed growth assays. MJA and JHW conceived of the project. MJA wrote and revised the manuscript with input from all other authors.
Author Information
The authors declare no competing financial interests
METHODS
Germplasm
Cuscuta was initially obtained from a California tomato field, and seed stocks derived from self-pollination through several generations in the Westwood laboratory. The isolate was initially identified as Cuscuta pentagona (Engelm.) C. pentagona is very closely related to C. campestris (Yunck.), and the two are distinguished by microscopic differences in floral morphology; because of this they have often been confused1. We subsequently determined that our isolate is indeed C. campestris. Arabidopsis thaliana sgs2-1 mutants2 were a gift from Hervé Vaucheret (INRA Versailles, France). A. thaliana dcl4-2t mutants (GABI_160G053) were obtained from the Arabidopsis Biological Resource Center (The Ohio State University, USA). A. thaliana seor mutants (GABI-KAT 609F044) were a gift from Michael Knoblauch (Washington State University, USA). The A. thaliana tir1-1/afb2- and afb3-4 mutants5 were a gift from Gabriele Monshausen (The Pennsylvania State University, USA). The bik1 mutant6 was a gift from Tesfaye Mengiste (Purdue University, USA). The scz2 mutant7 was a gift from Renze Heidstra (Wageningen University, The Netherlands). All A. thaliana mutants were in the Col-0 background.
Growth conditions and RNA extractions
For initial experiments (small RNA-seq and RNA blots in Figure 1) A. thaliana (Col-0) plants were grown in a growth room at 18-20°C with 12-h light per day, illuminated (200 μmol m-2s-1) with metal halide (400W, GE multi-vapor lamp) and spot-gro (65W, Sylvania) lamps. C. campestris seeds were scarified in concentrated sulfuric acid for 45 min, followed by 5-6 rinses with distilled water and dried. C. campestris seeds were placed in potting medium at the base of four-week-old A. thaliana seedlings and allowed to germinate and attach to hosts. The C. campestris plants were allowed to grow and spread on host plants for an additional three weeks to generate a supply of uniform shoots for use in the experiment. Sections of C. campestris shoot tip (∼10 cm long) were placed on the floral stem of a fresh set of A. thaliana plants. Parasite shoots coiled around the host stems and formed haustorial connections. Tissues from plants that had established C. campestris with at least two coils around healthy host stems and clear parasite growth were used in these studies. Control plants were grown under the same conditions as parasitized plants, but were not exposed to C. campestris.
For the preparation of tissue-specific small RNA libraries, tissues were harvested after C. campestris cuttings had formed active haustorial connections to the host. This was evidenced by growth of the C. campestris shoot to a length of at least 10 cm beyond the region of host attachment (7-10 d after infection). Three tissues were harvested from the A. thaliana-C. campestris associations: 1) 2.5 cm of A. thaliana stem above the region of attachment, 2) A. thaliana and C. campestris stems in the region of attachment (referred to as the interface), 3) 2.5 cm of the parasite stem near the point of attachment. To remove any possible cross-contamination between A. thaliana and C. campestris, harvested regions of the parasite and host stem were taken 1 cm away from the interface region and each harvested tissue was surface cleaned by immersion for 5 min in 70% ethanol, the ethanol was decanted and replaced, the process was repeated three times and the stems were blotted dry with a Kimwipe after the final rinse. All three sections of tissue were harvested at the same time and material from 20 attachments were pooled for small RNA extraction. Small RNA was extracted from ∼ 100 mg of each tissue using the mirPremier microRNA Isolation Kit (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s protocol. Small RNA was analyzed using an Agilent small RNA Kit on a 2100 Bioanalyzer platform.
Samples used for RNA ligase-mediated 5' rapid amplification of cDNA ends (5'-RLM-RACE; Figure 2D), quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR; Figure 3A) analyses of A. thaliana targets were prepared as described above with the following modifications: Col-0 A. thaliana hosts were cultivated in a growth room with 16 hr. days, 8 hr. nights, at ∼23C, under cool-white fluorescent lamps, attachment of C. campestris cuttings was promoted by illumination with far-red LED lighting for 3-5 days, and total RNA was extracted using Tri-reagent (Sigma) per the manufacturer’s suggestions, followed by a second sodium-acetate / ethanol precipitation and wash step. Samples used for RNA blots of secondary siRNA accumulation from A. thaliana mutants and replicate small RNA-seq libraries were obtained similarly, except that the samples derived from the primary attachments of C. campestris seedlings on the hosts instead of from cuttings. In these experiments, scarified C. campestris seedlings were first germinated on moistened paper towels for three days at ∼28C, then placed adjacent to the host plants with their radicles submerged in a water-filled 0.125ml tube.
C. campestris pre-haustoria (Extended Data Figure 8) were obtained by scarifying, germinating and placing seedlings as described above, next to bamboo stakes in soil, under illumination from cool-white fluorescent lights and far-red emitting LEDs. Seedlings coiled and produced pre-haustoria four days after being placed, and were harvested and used for total RNA extraction (used for RNA blot in Figure 4B) using Tri-reagent as described above. Nicotiana benthamiana was grown in a growth room with 16 hr. days, 8 hr. nights, at ∼23C, under cool-white fluorescent lamps. Three-to four-week old plants served as hosts for scarified and germinated C. campestris seedlings. Attachments were promoted by three-six days with supplementation by far-red emitting LEDs. Under these conditions, C. campestris attached to the petioles of the N. benthamiana hosts, not the stems. Interfaces and control petioles from un-parasitized hosts were collected 7-8 days after successful attachments, and total RNA (used for RNA blots in Figure 4B and small RNA-seq libraries) recovered using Tri-reagent as described above.
small RNA-seq
The initial small RNA-seq libraries were constructed using the Illumina Tru-Seq small RNA kit per the manufacturer’s protocol and sequenced on an Illumina HiSeq2500 instrument. Subsequent small RNA-seq libraries (replicate two using A. thaliana hosts, and the N. benthamiana experiments) instead used New England Biolabs NEBnext small RNA library kit, following the manufacturer’s instructions. Raw sRNA-seq reads were trimmed to remove 3'-adapters, and filtered for quality and trimmed length >= 16 nts using cutadapt8 version 1.9.1 with settings "-a TGGAATTCTCGGGTGCCAAGG –discard-untrimmed -m 16 –max-n=0". For experiments where A. thaliana was the host, trimmed reads that aligned with zero or one mismatch (using bowtie9 version 1.1.2, settings "-v 1") to the A. thaliana plastid genome, the C. gronovii plastid genome (C. gronovii was the closest relative to C. campestris that had a publically available completed plastid genome assembly available), A. thaliana rRNAs, tRNAs, snRNAs, or snoRNAs were removed. Similarly, for experiments where N. benthamiana was the host, the reads were cleaned against the C. gronovii plastid genome, the N. tabacum plastid genome and rRNAs, and a set of tRNAs predicted from the N. benthamiana genome using tRNAscanSE.
For the original A. thaliana host data, the 'clean' reads were aligned and analyzed with reference to the combined TAIR10 A. thaliana reference genome and a preliminary version 0.1 draft genome assembly of C. campestris using ShortStack10 (version 3.8.3) using default settings. The resulting annotated small RNA loci (Supplementary Data 1) were analyzed for differential expression (I vs. PS) using DESeq211, with a log2 fold threshold of 1, alternative hypothesis of "greaterAbs", and alpha of 0.05. p-values were adjusted for multiple testing using the Benjamini-Hochberg procedure, and loci with an adjusted p-value of <= 0.05 (equivalent to an FDR of <= 0.05) were called up-regulated in I relative to PS. Among the up-regulated loci, those annotated by ShortStack as MIRNAs deriving from the C. campestris genome which produced either a 21nt or 22nt mature miRNA (Supplementary Data 2) were retained and further analyzed. The predicted secondary structures and observed small RNA-seq read coverage was visualized (Supplementary Data 3-4) using strucVis (version 0.3; https://github.com/MikeAxtell/strucVis).
For analysis of mRNA-derived secondary siRNAs, the 'clean' small RNA-seq reads from the original A. thaliana experiment were aligned to the combined TAIR10 representative cDNAs from A. thaliana and our preliminary version 0.1 transcriptome assembly for C. campestris, using ShortStack10 version 3.8.3, with settings –mismatches 0, –nohp, and defining the full length of each mRNA as a 'locus' using option –locifile. The resulting counts of small RNA alignments for each mRNA were used for differential expression analysis, comparing I vs. HS, using DESeq2 11 as described above. A. thaliana mRNAs with significantly up-regulated (FDR <= 0.05) small RNAs comparing I vs. HS were retained for further analysis. The cDNA sequences of these loci were retrieved, and used for miRNA target predictions using GSTAr (version 1.0; https://github.com/MikeAxtell/GSTAr); the full set of mature miRNAs and miRNA*’s (Supplementary Data 2) from the I-induced C. campestris MIRNA loci were used as queries.
Analysis of the second set of A. thaliana - C. campestris small RNA-seq data aligned the cleaned reads to the combined A. thaliana and C. campestris reference genomes as described above, except that the list of loci derived in the analysis of the original data (Supplementary Data 1) was used as a "-locifile" in the ShortStack analysis. Differential expression analysis was then performed using DESeq2 as described above. Analysis of the N. benthamiana - C. campestris small RNA-seq data began with a ShortStack analysis of the cleaned reads against the combined N. benthamiana (version 0.4.4) genome and the preliminary assembly of the C. campestris genome, using default settings. The de novo N. benthamiana loci obtained from this run were retained. The resulting alignments were used to quantify small RNA abundance from the C. campestris small RNA loci defined with the original data. The resulting read counts were then used for differential expression analysis with DESeq2 as described above. Analysis of secondary siRNAs derived from N. benthamiana mRNAs was performed similarly as the A. thaliana mRNA analysis described above, except that the combined transcriptomes were from C. campestris and N. benthamiana (version 0.4.4 annotations).
RNA blots
Small RNA gel blots were performed as previously described12 with modifications. For the blots in Figure 1B, small RNAs (1.8 micrograms) from each sample were separated on 15% TBE-Urea Precast gels (Bio-Rad), transblotted onto the Hybond NX membrane and cross-linked using 1-ethyl-3-(3-dimethylamonipropyl) carbodiimide13. Hybridization was carried out in 5×SSC, 2×Denhardt’s Solution, 20 mM sodium phosphate (pH 7.2), 7% SDS with 100 μg/ml salmon testes DNA (Sigma-Aldrich). Probe labeling, hybridization and washing were performed as described12. Radioactive signals were detected using Typhoon FLA 7000 (GE Healthcare). Membranes were stripped in between hybridizations by washing with 1% SDS for 15 min at 80°C and exposed for at least 24 h to verify complete removal of probe before re-hybridization. Sequences of probes are listed below. Blots in Figures 3B and 4B were performed similarly, except that 12 micrograms of total RNA were used instead. Probe sequences are listed in Supplementary Data 6.
5' RNA ligase-mediated rapid amplification of cDNA ends (5'-RLM-RACE)
Five micrograms of total RNA were ligated to one microgram of a 44 nucleotide RNA adapter (Supplementary Data 6) using a 20ul T4 RNA ligase 1 reaction (NEB) per the manufacturer’s instructions for a one-hour incubation at 37C. The reaction was then diluted with 68ul of water and 2ul of 0.5M EDTA pH 8.0, and incubated at 65C for 15 minutes to inactivate the ligase. Sodium acetate pH5.2 was added to a final concentration of 0.3M, and the RNA precipitated with ethanol. The precipitated and washed RNA was resuspended in 10ul of water. 3.33ul of this sample was used as the template in a reverse transcription reaction using random primers and the Protoscript II reverse transcriptase (NEB) per the manufacturer’s instructions. The resulting cDNA was used as template in first round PCR using a 5' primer matching the RNA adapter and a 3' gene-specific primer (Supplementary Data 6). 1ul of the first round PCR product was used as the template for nested PCR with nested primers (Supplementary Data 6). Gene-specific primers for A. thaliana cDNAs were based on the representative TAIR10 transcript models, while those for N. benthamiana cDNAs were based on the version 0.4.4 transcripts (Sol Genomics Network14). In Figure 4c, N. benthamiana TIR/AFB is transcript ID NbS00011315g0112.1; N. benthamiana ARF is transcript ID NbS00059497g0003.1. Bands were gel-purified from agarose gels and cloned into pCR4-TOPO (Life Tech). Inserts from individual clones were recovered by colony PCR and subject to Sanger sequencing.
Quantitative reverse-transcriptase PCR (qRT-PCR)
Total RNA used for qRT-PCR was first treated with DNaseI (RNase-free; NEB) per the manufacturer’s instructions, ethanol precipitated, and resuspended. 2 micrograms of treated total RNA was used for cDNA synthesis using the High Capacity cDNA Synthesis Kit (Applied Biosystems) per the manufacturer’s instructions. PCR reactions used PerfeCTa SYBR Green FastMix (Quanta bio) on an Applied Biosystems StepONE-Plus quantitative PCR system per the manufacturer’s instructions. Primers (Supplementary Data 6) were designed to span the miRNA target sites, to ensure that only uncleaved mRNAs were measured. Three reference mRNAs were used: ACTIN, PP2A (PP2A sub-unit PDF2; At1g13320), and TIP41-l (TIP41-like; At4g34270) 15. Raw Ct values were used to calculate relative normalized expression values to each reference mRNA separately, and the final analysis took the median relative expression values between the ACTIN- and TIP41-l normalized data.
C. campestris growth assays
C. campestris seedlings were scarified, pre-germinated, and placed next to hosts in 0.125ml water-filled tubes under cool-white fluorescent lighting supplemented with far-red emitting LEDs (16hr day, 8hr night) at ∼ 23C as described above. After a single attachment formed (4 days), far-red light supplementation was removed to prevent secondary attachments. After 18 more days of growth, entire C. campestris vines were removed and weighed (Figure 3C). Multiple additional growth trials were performed specifically on the dcl4-2t and sgs2-1 mutant hosts under varying conditions (Extended Data Figure 4).
miRNA target predictions
To find probable orthologs for Arabidopsis thaliana genes of interest, the A. thaliana protein sequences were used as queries for a BLASTP analysis of the 31 eudicot proteomes available on Phytozome 11 (https://phytozome.jgi.doe.gov/pz/portal.html#). Transcript sequences for the top 100 hits were retrieved. In some cases no hits from a particular species were found; these are 'N/A' on Figure 4a. The miRNA query set was all mature miRNAs and miRNA*s from the I-induced, C. campestris-derived 21nt or 22nt MIRNAs (Supplementary Data 2). Targets were predicted from the probable 31-species with a maximum score of 4.5 using targetfinder.pl (https://github.com/MikeAxtell/TargetFinder/) version 0.1.
N. benthamiana orthologs of A. thaliana proteins were found based on BLAST-P searches against the version 0.4.4 N. benthamiana protein models at Sol Genomics Network14, and miRNA target sites predicted using targetfinder.pl as above.
Code availability
ShortStack10 (small RNA-seq analysis), strucVis (visualization of predicted RNA secondary structures with overlaid small RNA-seq depths), and Shuffler.pl/targetfinder.pl (prediction of miRNA targets controlling for false discovery rate) are all freely available at https://github.com/MikeAxtell. Cutadapt version 1.9.18 is freely available at http://cutadapt.readthedocs.io/en/stable/index.html. The R package DESeq211 is freely available at http://www.bioconductor.org/packages/release/bioc/html/DESeq2.html.
Data Availability
Small RNA-seq data from this work are available at NCBI GEO under accession GSE84955 and NCBI SRA under project PRJNA408115. The draft, preliminary C. campestris genome and transcriptome assemblies used in this study are available at the Parasitic Plant Genome Project website at http://ppgp.huck.psu.edu.
Acknowledgements
We thank the Penn State & Huck Institutes Genomics Core Facility for small RNA-seq services. We thank Hervé Vaucheret, Michael Knoblauch, Gabriele Monshausen, Tesfaye Mengiste, and Renze Heidstra for gifts of A. thaliana mutant seed. We thank Beth Johnson for advice on growing conditions for C. campestris. Purchase of the Illumina HiSeq2500 used for small RNA-seq was funded by a major research instrumentation award from the US National Science Foundation [1229046 to MJA and CWD]. This research was supported in part by awards from the US National Science Foundation [1238057 to JHW and CWD; 1339207 to MJA] and the National Institute of Food and Agriculture [135997 to JHW].