Abstract
How olfactory stimuli are perceived as meaningful cues for specific appetitive drives remains poorly understood. Here we show that despite their enormous diversity, Drosophila larvae can discriminatively respond to food-related odor stimuli based on both qualitative and quantitative properties. Perceptual processing of food scents takes place in a neural circuit comprising four dopamine (DA) neurons and a neuropeptide F (NPF) neuron per brain hemisphere. Furthermore, these DA neurons integrate and compress inputs from second-order olfactory neurons into one-dimensional DA signals, while the downstream NPF neuron assigns appetitive significance to limited DA outputs via a D1-type DA receptor (DoplR1)-mediated gating mechanism. Finally, Dop1R, along with a Gβ13F/Irk2-mediated inhibitory and a Gαs-mediated excitatory pathway, underlie a binary precision tuning apparatus that restricts the excitatory response of NPF neurons to DA inputs that fall within an optimum range. Our findings provide fresh molecular and cellular insights into cognitive processing of olfactory cues.
Summary
Olfaction is an ancient sense that is vital to the survival of animals across evolution. For example, to successfully search for distant or hidden energy sources in an ecological niche, a forager must be able to selectively recognize diverse food-related volatiles among others and evaluate their potential reward values. In addition, olfaction is also known to be functionally interconnected to other senses such as taste, and it may significantly impact cognitive functions that facilitate food detection and competition1–4. Therefore, elucidation of conserved neural substrates and mechanisms underlying cognitive processing of food odor stimuli in behaving animals is likely to provide valuable insights into the inner workings of the brain and its evolution.
Numerous studies have revealed that insects and mammals appear to share remarkable anatomical and functional similarities at multiple levels, including odor detection by olfactory receptor neurons, wiring schemes for relaying sensory inputs to second-order projection neurons as well as the presence of analogous spatial maps encoding processed odor information in the higher-order processing center (e.g., the lateral horn in flies and the cortical amygdala in mice that controls innate olfactory behaviors) 5,6. However, despite of such extensive knowledge about the sensory processes within the initial two steps of the olfactory circuit, how olfactory information is represented to deeper brain regions and translated to motivated behaviors remains largely unclear.
Genetically tractable Drosophila larvae have an advanced yet numerically simpler nervous system. We recently developed a fly larva model that is potentially useful for studying higher-order processing of food-related odor stimuli7. In response to a brief presentation of a bananalike scent or balsamic vinegar vapor, well-nourished fly larvae have been shown to display an aroused appetitive state in anticipation of sugar food. In this work, we show that in response to food-related odors Drosophila larvae display macronutrient-specific appetitive arousal in an inverted U manner. By taking genetic, pharmacological and neurobiological approaches, we show that perceptual recognition of appetitive odor stimuli requires a neural circuit comprising an ensemble of four DA neurons and a downstream neuropeptide F (NPF, a sole fly homolog of mammalian neuropeptide Y or NPY) neuron per brain hemisphere. These DA neurons, previously shown to form synaptic connections with second-order olfactory (projection) neurons 7, integrate and compress olfactory inputs from projection neurons to one-dimensional DA outputs. The NPF neuron functionally interacts with the upstream DA neurons by selectively assigning appetitive significance to a narrow spectrum of incoming DA signals via a D1-type DA receptor (Dop1R1)-mediated gating mechanism. We also provide evidence that Dop1R, along with a Gβ13F/Irk2-mediated inhibitory and a Gαs-mediated excitatory pathway, define a binary precision tuning apparatus in the NPF neuron that restricts the host cell response to DA inputs within an optimum range. Together, our findings suggest that the fly larva is a useful animal model for mechanistic studies of perceptual and other cognitive processing of olfactory and possible other sensory cues.
Results
Attribution of anticipated food reward to discrete odor stimuli
Well-nourished Drosophila larvae display a persistent state of appetitive arousal in anticipation of sugar food after a brief stimulation of food odors 7. Such odor-aroused food anticipation in individual larvae can be demonstrated, following the removal of the odor stimulus, by measuring the contraction rate of external mouth hooks that larvae use to scoop glucose-containing liquid food into the oral cavity 7,8 To investigate how food-related olfactory stimuli of varied chemical property and strength are perceptually processed, we first evaluated larval appetitive responses to three chemotactically attractive monomolecular odorants, pentyl acetate (PA), heptanal (Hep) or trans-2-hexenal (T2H) at various doses9. We found that while the effective dose range of each odorant differed significantly, their appetizing effects invariably followed an inverted-U function (Figure 1A-C). In addition, balsamic vinegar vapor, a chemically complex odor mixture, also exhibited inverted-U effects (Figure 1D).
We also examined whether fed larvae, aroused by a particular appetitive stimulus (e.g., 5μl PA), display motivational specificity to a selected type(s) of macronutrients. In addition to 10% glucose medium, 3% oleic acid (unsaturated fatty acid) and 0.5% tryptone (digested protein) diets are also palatable to fly larvae 10,11, as evidenced by similar baseline feeding activities of fed larvae in each food medium. However, when stimulated by PA, fed larvae exhibited an increased feeding response to glucose but not oleic acid and tryptone media (Figure 1E). Therefore, these results suggest that fly larvae are endowed with an innate ability to selectively extract salient features from diverse food-related odor stimuli based on their chemical properties and strengths and to differentially attribute a specific type(s) of anticipated food reward to a particular olfactory cue.
DA neuronal responses to appetizing and non-appetizing odor stimuli
How do fly larvae perceptually judge whether an odor stimulus is appetizing or not? To address this question, we turned our attention to a cluster of DA neurons (named DL2-1 to 4 in each brain lobe) that are essential for larval appetitive response to PA 7; Figure 2A). By taking advantage of the fluorescent Ca2+ sensor named CaMPARI (Calcium Modulated Photoactivatable Ratiometric Integrator) 12, we quantitatively analyzed the excitatory responses of the DL2 neurons to an effective dose of an odorant(s) in behaving fed larvae. The odor stimulations were performed under the same conditions as described for feeding behavioral assays, followed immediately by 5-sec irradiation with 405 nm blue light. This light irradiation irreversibly turns Ca2+-bound CaMPARI protein from green to red fluorescence, thereby capturing the excitatory state of the DL2 neurons in the aroused larvae. We observed that stimulation by an appetizing dose of PA (7μl) induced excitatory responses from the four DA neurons in each cluster, as evidenced by increased red fluorescence signals in the DL2 neurons over a 5-min test period (Figure 2B). Similarly, an appetizing dose of balsamic vinegar (20 μl) also triggered a similar rise of intracellular Ca2+ levels in the DL2 neurons during its stimulation.
In parallel, we also examined how the DL2 neurons respond to an ineffective dose of PA in fed larvae under the same experimental conditions. In response to 20μl PA stimulation, DL2 neurons showed a rapid surge of intracellular Ca2+ within the first minute, followed by a gradual reduction of the Ca2+ increase as the stimulation time is prolonged (Figure 2C). Therefore, the ineffectiveness of 20μl PA to arouse appetitive behavior may be accounted for by two different explanations. One possibility is that 20μl PA may cause the silencing of DL2 neurons during the 5-minute stimulation, thereby disrupting acutely required DA signaling to downstream targets. Alternatively, its stimulation may trigger an excessive release of DA, which is functionally ineffective. To distinguish the two possibilities, we genetically activated the DL2 neurons over different time periods using dTrpA1, a temperature-sensitive TRP family cation channel13. A brief activation of these neurons triggered an increased larval feeding response in the absence of odor stimuli, while the prolonged activation still failed to do so (Figure 2D; also see Figure supplement 1). In addition, fed larvae stimulated by 20μl PA for 30 seconds instead showed a significant increase in their feeding response (Figure 2E). Together, these results support the notion that an excessive release of odor-evoked DA signals rather than silencing of the DA neurons is responsible for the ineffectiveness of higher doses of odors.
Quantitative influences of endogenous DA levels on the appetizing effects of odor stimuli
Since an excessive release of odor-evoked DA likely underlies the ineffectiveness of stronger odor stimuli, we wondered whether reduction of the endogenous level of DA in fed larvae could increase the dosage required for appetitive arousal. To test this hypothesis, we performed RNA interference (RNAi)-mediated knockdown of the activity of Tyrosine Hydroxylase (TH), a rate-limiting enzyme for DA synthesis 14. The fly ple gene encodes Tyrosine Hydroxylase. Indeed, TH-GAL4/UAS-pleRNAi fed larvae showed significantly increased appetitive responses to higher doses of odorants (e.g., 20μl PA) that are normally ineffective, but they failed to respond to normally effective doses of odorants (e.g., 5μl PA; Figure 3A). In a separate pharmacological experiment, we pre-fed normal larvae with food containing a TH inhibitor, 3IY, for 4 and 6 hours. The 3IY-treated larvae failed to show appetitive response to a normally effective dose of PA (Figure 3B). In parallel, we also tried to increase the endogenous DA level by pre-feeding larvae with L-Dopa, a dopamine precursor, for 2 and 4 hours. We found that 4 hour pre-feeding with L-Dopa blocked the appetitive response to a normally effective dose (e.g., 5μl or 10μl PA). Conversely, the same L-Dopa treatment rendered a lower ineffective dose of PA to elicit an appetitive response (Figure 3C).
Since pre-feeding of L-dopa can augment the appetizing effect of PA at a low dose, we tested whether another lower ineffective dose of odorant (e.g., 12.5μl Hep; see Figure 1B) can be used to substitute the L-dopa treatment for appetitive arousal. Indeed, simultaneous stimulation by 2.5μl PA and 12.5μl Hep was able to significantly increase larval appetitive response (Figure 3D). In contrast, the combined use of two effective doses of PA and Hep was ineffective in appetitive arousal. However, such a binary mixture became effective if the testing larvae have reduced TH-activity or pre-fed with 3IY (Figure 3D). Together, these findings suggest that the minimal strength of an odor stimulus required to arouse appetite is inversely correlated with the baseline level of DA in fed larvae.
Odor-evoked DA signals acquire motivational salience through a Dop1R1 gating mechanism
Our findings so far have demonstrated the importance of an optimum level of odor-evoked DA signals for larval appetitive arousal. Since the DA receptor Dop1R1 has been shown to mediate the appetitive arousal of fed larvae 7, we decided to examine whether Dop1R1 plays a role in presetting the effective dosage of odor-evoked DA signals in fed larvae. Heterozygous Dop1R1f02676 larvae have a 50% reduction of Dop1R1 transcripts 15. We found that in response to various doses of monomolecular or mixed odorants, Dop1R1f02676/+ fed larvae displayed a right shift in the dose-response curve (Figures 3E and Figure3--Figure supplement 2). Furthermore, pre-feeding of L-dopa restored their appetitive responses to a normally effective dose of PA (10μl, Figures 3F). Therefore, these findings suggest that Dop1R1 is a major genetic factor that quantitatively delimits the optimum range of effective DA levels, and individual animals with varied Dop1R1 levels likely require distinct levels of odor-evoked DA signals for appetitive arousal.
Roles of two dorsomedial DA neurons in odor-aroused appetite
Our previous study showed that the Drosophila neuropeptide Y-like NPF system contributes to the odor-aroused feeding response of fed larvae by modulating the excitatory responses of the DL2 neurons to olfactory stimuli7. Anatomical analyses have revealed that a npf-GAL4 driver predominantly labels six NPF neurons in the larval central nervous system (CNS; Figure 4A, B; 16,17 Another npf-LexA driver, which predominantly labels two dorsomedial NPF neurons in the larval brain, shows that their dendrites are enriched in the lateral horn region (Figure4--Figure supplement 3). To determine which subset(s) of NPF neurons is necessary to induce appetitive arousal, we performed targeted laser lesioning of NPF neurons. We found that odor-stimulated fed larvae missing the two-lesioned dorsomedial NPF neurons failed to display appetitive response, while those larvae with two lesioned dorsolateral NPF neurons showed normal appetitive behavior (Figure 4C).
Given that NPF signaling was previously implicated in modulation of DL2 neuronal responses to the outputs from second-order projection neurons, we decided to determine the observed activity of the dorsomedial NPF neuron could be explained by its positive regulation of the upstream DA neurons. To test this possibility, we used a fluorescent Ca2+ indicator, GCaMP6 to analyze the excitatory responses of four DL2 neurons to PA stimulation over a 60-sec period in the presence or absence of two dorsomedial NPF neurons. We found that in both cases, the odor responses of DL2 neurons were largely similar. We also performed a reciprocal imaging test under the same odor treatment. In the presence of the DL2 neurons, the NPF neurons were excited by the PA stimulation, but their odor responses were significantly attenuated when the two clusters of DL2 neurons were lesioned (Figure 4D). We also observed that the DL2 neurons responded to the PA stimulation within a few seconds. However, the response of the NPF neurons showed a significant time lag of up to 25 seconds. These results raise the possibility that the dorsomedial NPF neurons may contribute to a yet uncharacterized circuit mechanism by acting downstream from odor-responsive DL2 neurons.
To test this hypothesis, we functionally knocked down Dop1R1 activity in npf-GAL4/Dop1R1RNAi fed larvae. Similar to Dop1R1/+ fed larvae mutant larvae, these Dop1R1-deficient larvae displayed a right shift of the dose-response curve, phenocopying (Figures 4E, also see Figure4--Figure supplement 3). Also, fed larvae expressing UAS-npfRNAi under the direction of npf-GAL4 showed no significant appetitive response to odorants (e.g., PA and Hep) at any of the doses tested, revealing an essential role of NPF in arousing larval appetite. Furthermore, we genetically activated NPF neurons using a fly TRP family channel, dTrpA1 18. The npf-GAL4/UAS-dTrpA1 fed larvae, heat shocked at 31°C for 15 or 30 min, showed increased feeding activity even in the absence of appetitive odor stimuli (Figures. 4F and Figure4--Figure supplement 3). In addition, the npf-GAL4/UAS-dTrpA1 larvae with lesions in two dorsomedial but not dorsolateral NPF neurons failed to show increased feeding response, demonstrating that activation of the two dorsomedial NPF neurons is sufficient to induce appetitive arousal in fed larvae (Figure. 4G). The expression of dTrpA1 in Dop1R1-deficient NPF neurons also led to bypassing the requirement of Dop1R1 activity to trigger appetitive arousal in an odor-independent manner (Figure 4H), suggesting that Dop1R1 is involved in modulation of DA-mediated excitation of NPF neurons rather than NPF release. Finally, we performed an imaging analysis using a split GFP technique 19. This analysis has revealed that the two dorsomedial NPF neurons likely form synaptic connections with the ipsilateral cluster of DL2 neurons in the lateral horn (Figures 4I; also see Video 1). Together, our findings suggest that the dorsomedial NPF neuron and four upstream DA neurons define a neural circuit for perceptual processing of information encoded by a common pool of odor-evoked DA from the DL2 neurons.
NPF neuronal responses to appetizing and non-appetizing odor stimuli
NPF has been implicated in encoding motivational states for a variety of goal-directed behaviors in larval and adult flies 20–24 We postulate that the dorsomedial NPF neuron may contribute to a food odor-aroused motivational state in fed larvae by selectively assigning appetitive significance to DA signals that fall within a limited range. To test this hypothesis, we examined how the dorsomedial NPF neurons respond to appetizing and non-appetizing odor stimuli. We first examined the potential impact of PA stimulation on the membrane potentials of the dorsomedial NPF neurons in a larval preparation using a fluorescent indicator of membrane potential (Arclight) 25. The dorsomedial NPF neurons showed a gradual increase in excitatory response during a 10-minute continuous exposure to the vapor of PA at an effective dose. In contrast, when a higher ineffective dose of PA was applied, no excitatory responses were observed, except for a transient depolarization immediately following the odor application (Figure 5A and B). The responses of the dorsomedial NPF neurons to appetizing and nonappetizing odor stimuli were also analyzed in behaving larvae using CaMPARI-based imaging (Figure 5C). Similar to the Arclight imaging results, these neurons showed an excitatory response to an appetizing dose of PA (7μl), but failed to respond to non-appetizing PA doses that are either too high or too low (e.g., 20 or 3.5μl). Therefore, these results indicate that the inverted-U effects of odor stimuli can also be observed at the level of NPF neuronal excitation. On the other hand, in the Dop1R1-defieinct NPF neurons, the effective dose of PA required to activate the dorsomedial NPF neurons is upshifted from 7μl to 20μl PA.
A binary genetic mechanism for Dop1R1-mediated precision tuning of NPF signaling
A key remaining question is how Dop1R1 precisely tunes the two dorsomedial NPF neurons to assign appetitive salience to otherwise behaviorally meaningless DA signals. D1-type DA receptor is associated with the heterotrimeric G protein complex consisting of Gαs, Gβ, Gγ subunits 26. Upon its activation by DA, the dissociated Gαs subunit and Gβγ complex each defines a separate effector pathway. We found that RNAi-mediated knockdown of Gαs activity blocked appetitive response to PA at all doses tested (5 to 20 μl; Figures 5D, Figure5--Figure supplement 4). Furthermore, in freely behaving fed larvae, the reduced activity of Gαs also significantly attenuated the excitatory response of dorsomedial NPF neurons to an effective dose of PA (Figure 5E).
The Drosophila genome contains three separate genes each encoding a different Gβ subunit 27,28;. Functional knockdown of one of them, Gβ13F, in the NPF neurons of npf-GAL4/UAS-Gβ13FRNAi fed larvae led to an expansion of appetitive response to PA at all doses tested (from 5 to 40μl; Figure 5D, Figure5--Figure supplement 4). Since a G protein-dependent inward-rectify potassium channel could be a potential molecular target of the Gβγ complex 29, we functionally knocked down each of the three known IRK genes 30,31. Indeed, fed larvae that are deficient in IRK2 but not IRK1 or IRK3 activity phenocopied npf-GAL4/UAS-Gβ13FRNAi fed larvae (Figure 5D, Figure5--Figure supplement 4). In parallel, we also tested how the two dorsomedial NPF neurons in behaving npf-GAL4/UAS-Gβ13FRNAi and npf-GAL4/UAS-IRK2RNAi fed larvae respond to stimulation by 7 or 20 μl PA. We found that the dorsomedial NPF neurons expressing UAS-CaMPARI, along with UAS-Gβ13FRNAi or UAS-IRK2RNAi, displayed an abnormally high level of excitatory responses to the stimulation by a normally ineffective dose of PA (20μl), while their responses to 7μl PA remained similar (Figure 5E). These results show that when the Gβ13F/IRK2 pathway is deficient, the effective range of odor-induced DA signals is greatly expanded, converting the inverted U dose-response curve to the sigmoidal shape in these larvae. Together, our findings have revealed a binary genetic mechanism in the NPF neurons that underlies Dop1R1-gated coupling of odor-evoked DA and NPF signaling. Furthermore, Dop1R1 gating of the NPF neurons appears to employ a two-layered precision tuning strategy that ultimately shapes the inverted-U dose response of fed larvae: the Gαs-mediated excitatory pathway is used to set up a minimal threshold level of odor-evoked DA signals required for NPF neuronal excitation; the Gβ13F/IRK2-mediated inhibitory pathway is specialized for preventing NPF neuronal response to any odor-evoked DA signals that are excessively strong (Figure 6).
DISCUSSION
To date, how sensory inputs are perceptually processed in deep brain centers to arouse specific behavioral drives remains poorly understood 32. We have shown that Drosophila larvae display aroused appetite for selected macronutrients in response to stimulation by food-related odors. Using this behavioral paradigm, we have identified a pair of higher-order neural circuits for perceptual processing of appetitive odor stimuli, each comprising a cluster of four DA neurons and a postsynaptic Dop1R1 neuron expressing NPF, an NPY-like neuropeptide (Figure 6). Our studies suggest that fly larvae offer a useful model for elucidating molecular and neural mechanisms underlying perceptual processing of appetitive olfactory and possibly other sensory cues.
Contributions of DA signaling to larval perceptual judgment of appetitive odors
We have provided evidence that a subset of DA (DL2) neurons appears to make at least two major contributions to the perceptual processing of food-related olfactory stimuli. First, the DA neurons display excitatory responses to a broad spectrum of food-related odor stimuli, suggesting that they serve as a cognitive processing component for decoding and integration of chemically diverse food-related olfactory signals. Second, by genetic and pharmacological manipulations of the endogenous DA level, we have shown that the effective doses of odorants required for appetitive arousal must be significantly reduced in larvae pre-fed with L-dopa, or increased in larvae with reduced TH activity. These results suggest that the level of DA released from the DL2 neurons encodes both chemical identity and strength of an odor stimulus. Therefore, the DL2 neurons are essential for the compression of potentially multi-dimensional signals of food odors to one-dimensional DA codes.
The Dop1R1 gating mechanism for shaping the inverted-U dose response
The dose-response analysis shows that the appetizing effects of both monomolecular and mixed odor stimuli follow an inverted U function. We have also provided evidence that the amount of DA released from the DL2 neurons is positively correlated with the strength of odor stimulation, and induction of appetitive arousal requires an optimum level of odor-evoked DA released from the DL2 neurons. For example, a higher non-appetizing dose of PA (e.g., 20μl PA) triggered a rapid and intense excitatory response from the DA neurons. As the result, a 30-sec stimulation by 20μl PA triggered appetitive arousal while its stimulation for 5 minutes failed to do so. Another key insight from this study is that odor-evoked DA signals encode no intrinsic appetitive values. Instead, larval perceptual recognition of appetitive odor cues requires a Dop1R gating mechanism, which is preset genetically, to selectively assign appetitive significance to a narrow spectrum of the DA signals. For example, a 50% reduction of Dop1R1 activity in Dop1R1/+ larvae led to a right-shift of the dose-response curve regardless whether the odor stimulus is monomolecular or chemically complex. Therefore, to be perceived as appetizing cues, odor-evoked DA signals must fall within a narrow range that matches the pre-existing level of Dop1R1 activity.
The central role of NPF neurons in regulation of appetitive arousal
We have shown that two NPF neurons, located in the dorsomedial region of each brain lobe, are necessary and sufficient to elicit appetitive arousal in fed larvae. Anatomical and functional analyses also suggest that these NPF neurons likely form synaptic connections to the upstream clustered DL2 neurons ipsilaterally. In freely behaving fed larvae, the NPF neurons display excitatory responses to stimulation by appetizing doses of PA but not the non-appetizing doses, and such differential responses are gated by the Dop1R1 activity in the dorsomedial NPF neurons. Since dTRPA1-mediated genetic activation of the two dorsomedial NPF neurons, even under prolonged heat treatment, was sufficient to trigger increased feeding response, these results suggest that elevated NPF neuronal signaling plays an acutely role in the induction and maintenance of appetitive odor-aroused motivational state. It remains to be determined whether the NPF neurons are responsive to sugar stimulation. If so, this would provide evidence for an important role of these neurons in integrating DA-coded olfactory and sugar-evoked gustatory signals.
Precision tuning of Dop1R1-gated NPF neuronal response to odor-evoked DA signals
We have provided molecular and cellular evidence for how the Dop1R1 activity in the NPF neurons shapes the inverted-U effects of appetitive odor stimuli. Using both behavioral and functional imaging assays, we show that Dop1R1 determines which range of odor-evoked DA signals may acquire appetitive significance through precision tuning of NPF neurons. Two separate genetic pathways have been identified for this process (Figure 6B). One of them, involving a Gβ13F/IRK2-mediated pathway, sets an upper limit of the optimum effective range of odor-induced DA signals by silencing the NPF neurons when Dop1R1is hyper-activated. Attenuation of the Gβ13F or IRK2 activity greatly broadens the effective dose range of DA signals, as evidenced by the change of the dose-response curve from an inverted U shape to a sigmoidal shape. Again, this result also strongly supports the notion that the ineffectiveness of stronger odor stimuli is caused by an excessive release of odor-evoked DA, which leads to a high level of dissociated G complex that activates IRK2 channels and subsequently silences the NPF neurons. The second Dop1R1/Gαs-mediated pathway provides a default excitatory mechanism that mediates NPF neuronal response to any odor stimuli that are at or above the minimal threshold strength. Therefore, they together define a two-layered precision tuning strategy.
The inverted-U effects of DA on cognitive functions have been widely observed in humans and other animals 33,34 Malfunctioned dopamine systems also underlie many psychiatric disorders such as schizophrenia 35,36. In the prefrontal cortex of mammals, an optimum level of D1-type DA receptor activity is crucial for spatial working memory, while its signaling at levels that are too low or too high leads to impaired working memory 37–39. Therefore, our findings raise the possibility that a homologous DA receptor-mediated tuning strategy may be used to mediate the inverted-U effects of DA in flies and mammals.
Materials and Methods
Fly Stocks and Larval Growth
All flies are in the w1118 background. Larvae were reared at 25°C, and early third instars (∼74 hr after egg laying, AEL) were fed before behavioral experiments as previously described7 (Wang et al., 2013). The transgenic flies include TH-GAL4 (Friggi-Grelin et al., 2003), UAS-dTrpA1 (Hamada et al., 2008), UAS-nsybGFP 19, UAS-sytGFP40, UAS-Denmark (Nicolaï et al., 2010), UAS-GCaMP6.0(BL42749), UAS-pleRNAi (BL25796), UAS-GαsRNAi(BL29576), UAS-Gβ76CRNAi(BL28507), UAS-Gβ13FRNAi(BL35041), UAS-npfRNAi (BL27237), UAS-PKAi (BL35550), UAS-Arclight (BL51056), UAS-CaMPARI (BL58761), UAS-IRK2RNAi (BL41981), UAS-IRK1RNAi (BL42644), UAS-IRK3RNAi (BL26720), and npf-GAL4 were obtained from Bloomington stock center. UAS-Dop1R1RNAi (V107058) was obtained from the Vienna Drosophila RNAi Center. Dop1R1f02676 flies were described previously15. UAS-CD4::spGFP1-10, LexAop-CD4::spGFP11 were kindly provided by K. Scott 41.
Behavioral Experiments
Quantification of mouth hook contraction rate in liquid food was performed as previously described20. A published protocol for fly larvae odor stimulation was used with slight modifications7. Briefly, synchronized early third instars, fed on yeast paste, were stimulated for 5 minutes with specified doses of single or mixed odors including pentyl acetate (PA) (Sigma-Aldrich, 628-63-7), heptanal (Hep) (Sigma-Aldrich, 117-71-7), trans-2-Hexen-1-al (T2H) (Sigma-Aldrich, 6728-26-3), and the vapor of balsamic vinegar. After rinsing with water, larvae were tested for their feeding responses. Feeding media include agar paste (US Biological, A0940) containing 10% glucose, 0.5% Tryptone (Becton-Dickinson, 628200) or 3% oleic acid (Sigma-Aldrich, 112-80-1). UAS-dTrpA1 was expressed by allowing larvae to feed in prewarmed yeast paste in a 31°C incubator for defined periods, followed by rinsing with 31°C water prior to feeding assays.
3IY and L-dopa Feeding
3-iodo-L-tyrosine (3IY) (Sigma-Aldrich, 70-78-0) and L-DOPA-ring-d3 (L-dopa) (Sigma-Aldrich, 53587-29-4) were used. The protocols for administration of 3IY and L-dopa were described previously7. The concentrations of 3IY and L-dopa in yeast paste were 10mg/ml and 0.5mg/ml, respectively.
Molecular Cloning and Immunostaining
To construct the npf-LexA driver, a DNA fragment of ∼1-kb containing a region spanning from the 5’ regulatory sequence to the beginning of the second axon was amplified by genomic PCR. This fragment was subsequently cloned into the KpnI site in the pBPnlsLexA::GADflUw vector. Forward Primer: cagggagagagaacggagac; Reverse primer: gtgtcacaatgcaattgttcg. Tissue dissection and fixation, antibodies used and dilution conditions were described previously7.
Targeted Laser Lesion
Protocols for calibration of 337 nm nitrogen laser unit and laser lesion experiments have been described42.
CaMPARI Imaging
The conditions of larval feeding and odor treatment for CaMPARI imaging are identical to those for odor-aroused feeding behavioral assays. After odor stimulation, larvae were irradiated with PC light 405 nm LED array (200 mW/cm2, Loctite) for 5s. The treated larval CNS was dissected and individually scanned using a Zeiss LSM 510 confocal microscope.
GCaMP imaging
The neural tissues of larvae were processed as previously described7. A Ca2+ indicator, GCaMP6s, was used for imaging odor responses by DA and NPF neurons. The odor delivery system involves a sealed 1.25L glass chamber fumigated with 7.5μl PA for 5 minutes. Odor was continuously delivered to larval head region by pumping at the rate of 0.28 L/min. The treated larval preparation was imaged using a Zeiss LSM 510 confocal microscope.
Arclight imaging and data processing
The method for making larval CNS preparation is the same as previously described for calcium imaging preparation (7). The preparation was incubated in Drosophila PBS. Effective and ineffective odor vapors were prepared by fumigating a sealed 24L foam box with 150 or 800μl PA for 2 hours, respectively. Odor was continuously delivered to larval head region by pumping at the rate of 0.36L/min.
The protocol for ArcLight Imaging25 was followed with minor modifications. Briefly, larval CNS was imaged under 40X water immersion lens using Zeiss Axio Examiner. NeuroCCD-SM camera and Turbo-SM software (RedShirt Imaging) were used for recording and data processing. Images were captured at a frame rate of 100 Hz, and exposure time is 10ms. 2000 frames were collected for each of the seven 20s periods.
All the time series curves were low pass filtered with a Kaiser-Bessel 30 filter (200 Hz cut off). Then, each curve was fitted with a single exponential equation, I=Ae(-at). Bleaching of each curve was corrected based on the formula: It,corrected=It+(A----Ae(-at)). Normalization of each trace was achieved by dividing It,corrected with the average value. Standard deviation was obtained using normalized data.
Statistical Analysis
Statistical analyses for behavioral and CaMPARI imaging assays were performed using One-way ANOVA followed by Dunnett’s or Sidak’s multiple comparisons test.
SUPPLEMENTAL INFROMATION
Supplemental information includes Supplemental Experimental Procedures and four figures and one movie.
AUTHOR CONTRIBUTIONS
Y.P. and M.M.M. performed behavioral assays. Y.P. and Y.Z. designed and performed imaging analyses. P.S., Y.P. and M.M.M. wrote the paper.
ACKNOWLEDGMENTS
We thank J. Hirsh, K. Scott, F.W. Wolf, D.J. Anderson, the Bloomington Stock Center and Vienna Drosophila RNA I Center for fly stocks, and W. Neckameyer for anti-TH antibodies. We also thank P. Kner and K. Tehrani for help with processing of imaging data. This work is supported by grants from the U.S. National Institutes of Health (DK102209 and DC013333) to P.S.