Abstract
Anteroposterior axis extension during vertebrate gastrulation requires cell proliferation, embryonic patterning, and morphogenesis to be spatiotemporally coordinated, but the underlying genetic mechanisms remain poorly understood. Here we define a role for the conserved chromatin factor Gon4l, encoded by ugly duckling (udu), in coordinating tissue patterning and axis extension during zebrafish gastrulation. Although identified as a recessive enhancer of short axis phenotypes in planar cell polarity (PCP) mutants, we found that Gon4l functions in a genetically independent, partially overlapping fashion with PCP signaling to regulate mediolateral cell polarity underlying axis extension in part by promoting notochord boundary formation. We identified direct genomic targets of Gon4l and found that it acts as both a positive and negative regulator of gene expression, including limiting expression of the cell-cell and cell-matrix adhesion molecules EpCAM and Integrinα3b. Excess epcam or itga3b in wild-type gastrulae phenocopied notochord boundary defects of udu mutants, while downregulation of itga3b suppressed them. By promoting formation of this anteroposteriorly aligned boundary and associated cell polarity, Gon4l cooperates with PCP signaling to coordinate morphogenesis with the anteroposterior embryonic axis.
Gastrulation is a critical period of animal development during which the three primordial germ layers - ectoderm, mesoderm, and endoderm - are specified, patterned, and shaped into a rudimentary body plan. During vertebrate gastrulation, mesoderm and endoderm become internalized to underlie ectoderm and the three germ layers thin and expand through epibolic movements. The hallmark of the vertebrate body plan is an elongated anteroposterior (AP) axis that emerges as the result of convergence and extension (C&E), a conserved set of gastrulation movements characterized by the concomitant AP elongation and mediolateral (ML) narrowing of the germ layers1-4. C&E is accomplished by a combination of polarized cell behaviors, including directed migration and ML intercalation behavior (MIB)5-7. During MIB, cells elongate and align their bodies and protrusions in the ML dimension and intercalate preferentially between their anterior and posterior neighbors7. This polarization of cell behaviors with respect to the AP axis is regulated by the planar cell polarity (PCP) and other signaling pathways8-12. Because these pathways are essential for MIB and C&E but do not affect cell fates12-14, other mechanisms must spatiotemporally coordinate morphogenesis with embryonic patterning to ensure normal development. BMP, for example, coordinates dorsal-ventral axis patterning with morphogenetic movements by limiting expression of PCP signaling components and C&E to the embryo’s dorsal side15. In general, though, molecular mechanisms that coordinate gastrulation cell behaviors with axial patterning are poorly understood, and remain one of the key outstanding questions in developmental biology.
Epigenetic regulators offer a potential mechanism by which broad networks of embryonic patterning and morphogenesis genes can be co-regulated, conceivably by altering chromatin state within embryonic cells to regulate which subsets of genes are available for transcription. Epigenetic modifiers like Histone acetyl transferases (HATs), deacetylases (HDACs), and methyltransferases associate within protein complexes containing chromatin factors that are thought to regulate their binding at specific genomic regions in context-specific ways16. The identities, functions, and specificity of chromatin factors with roles during embryogenesis are only now being elucidated, and often have described roles in cell fate specification and embryonic patterning17-19. The contribution of epigenetic regulation to gastrulation cell movements, however, is particularly poorly understood.
Here, we describe the chromatin factor Gon4l, encoded by ugly duckling (udu), as a novel regulator of embryonic axis extension during zebrafish gastrulation. udu was identified in a forward genetic screen for enhancers of short axis phenotypes in PCP mutants, but we found it functions in parallel to PCP signaling. Instead, complete maternal and zygotic udu (MZudu) deficiency produced a distinct set of morphogenetic and cell polarity phenotypes that implicate the notochord boundary in ML cell polarity and cell intercalation during C&E. Extension defects in MZudu mutants were remarkably specific, as internalization, epiboly and convergence gastrulation movements occurred normally. Gene expression profiling revealed that Gon4l regulates expression of a large portion of the zebrafish genome, including housekeeping genes, patterning genes, and many with known or potential roles in morphogenesis. Furthermore, Gon4l-associated genomic loci were identified by DNA adenine methyltransferase identification20, 21 paired with high throughput sequencing (DamID-seq), revealing both positive and negative regulation of putative direct targets by Gon4l. Mechanistically, we found that increased expression of epcam and itga3b, direct targets of Gon4l-dependent repression during gastrulation, were largely causative of notochord boundary defects in MZudu mutants. This report thereby defines a critical role for a chromatin factor in the regulation of gastrulation cell behaviors in vertebrate embryos: by ensuring proper formation of the AP-aligned notochord boundary and associated ML cell polarity, Gon4l cooperates with PCP signaling to coordinate morphogenesis that extends the AP embryonic axis.
RESULTS
Gon4l is a novel regulator of axis extension during zebrafish gastrulation
To identify novel regulators of C&E, we performed a three generation synthetic mutant screen22, 23 using zebrafish carrying a hypomorphic allele of the planar cell polarity (PCP) gene knypek (kny)/glypican 4, knym81810. F0 wild-type (WT) males were mutagenized with N-ethyl, N-nitrosourea (ENU) and outcrossed to WT females. The resulting F1 fish were outcrossed to knym818/818 males (rescued by kny RNA injection) to generate F2 families whose F3 offspring were screened during early segmentation (11-14 hours post fertilization (hpf)) and late embryogenesis (24hpf) for short axis phenotypes (Fig.1a). Screening nearly 100 F2 families yielded eight recessive mutations that enhanced axis elongation defects in knym818/818 embryos. vu68 was found to be a new L227P kny allele, and vu64 was a new Y219* nonsense allele of the core PCP gene trilobite(tri)/vangl2, mutations in which exacerbate kny mutant phenotypes24, demonstrating effectiveness of our screening strategy. We focused on vu66/vu66 mutants, which displayed a pleiotropic phenotype at 24hpf, including shortened AP axes, reduced tail fins, and heart edema (Fig.1d, Supplemental Fig.1b).
Employing simple sequence repeat mapping strategy25,26, we mapped the vu66 mutation to a small region on Chromosome 16 that contains the ugly duckling (udu) gene (Fig.1b). udu encodes a conserved chromatin factor homologous to gon4 in C. elegans and the closely related Gon4l in mammals27. The previously described udu mutant phenotypes resemble those of homozygous vu66 embryos, including a shorter body axis and fewer blood cells27, 28, making udu an excellent candidate for this novel PCP enhancer. Sequencing cDNA of the udu coding region from 24hpf vu66/vu66 embryos revealed a T to A transversion at position 2,261 predicted to change 753Y to a premature STOP codon (Fig.1g). Furthermore, vu66 failed to complement a known udusq1 allele27 (Supplemental Fig.1c). Together, these data establish vu66 as a new udu allele and identify it as a recessive enhancer of axis extension defects in kny PCP mutant gastrulae.
Complete loss of maternal and zygotic udu function impairs axial extension
A majority of zebrafish genes are expressed maternally29, 30, and their expression can mask the effect of zygotic mutations on embryo patterning and gastrulation31, 32. Because udu is highly maternally expressed27, we employed germline replacement33 to generate otherwise WT females carrying uduvu66/vu66 (udu-/-) germline, and therefore lacking maternal udu expression. Females harboring uduvu66/vu66germline were crossed to uduvu66/+ or uduvu66/vu66 germline males to produce 50% or 100% embryos lacking both maternal (M) and zygotic (Z) udu function, respectively, hereafter referred to as MZudu mutants. Strict maternal loss of udu produced no obvious phenotypes (Fig.4a). MZudu-/- embryos appeared outwardly to develop normally until mid-gastrula stages (Fig.1i), specified the three germ layers (Fig.1m, Supplemental Fig.2), formed an embryonic shield marked by gsc expression (Supplemental Fig.2c,d), and completed epiboly on schedule (Fig.1i). However, they exhibited clear abnormalities at the onset of segmentation, as somites were largely absent in mutants (Fig.1k,o). Although myoD expression was observed within adaxial cells by whole mount in situ hybridization (WISH), its expression was not detected in nascent somites (Fig. 1o). Formation of adaxial cells is consistent with normal expression of their inducer shh in the axial mesoderm34 (Supplemental Fig.2h), and ntla/brachyury expression in the axial mesoderm was also largely intact (Supplemental Fig.2j). Importantly, MZudu-/- embryos were markedly shorter than age-matched WT controls throughout segmentation (Fig.1k) and at 24hpf (Supplemental Fig. 3e,h, Fig.4b). Although increased cell death was observed in MZudu and Zudu mutants35, inhibiting apoptosis within MZudu embryos via injection of RNA encoding the anti-apoptotic mitochondrial protein Bcl-xL36 did not suppress their short axis phenotype (Supplemental Fig.3a-f). MZudu mutants displayed a number of other phenotypes, including blood27, 28 and cardiac deficiencies, which will be described further elsewhere (Budine, Williams, LSK, unpublished). These results demonstrate a role for Gon4l in axial extension during gastrulation.
Gon4l regulates formation of the notochord boundary
Time-lapse Nomarski (Fig.2a-b) and confocal (Fig.2c-d) microscopy of dorsal mesoderm in MZudu-/- gastrulae revealed reduced definition and regularity of the boundary between axial and paraxial mesoderm, hereafter referred to as the notochord boundary, compared to WT (Fig.2a-b, arrowheads). The ratio of the total/net length of notochord boundaries was significantly higher in MZudu-/- than in WT gastrulae at all time points (Fig.2e), indicative of decreased straightness. Interestingly, Laminin was detected by immunostaining at the notochord boundary of both WT and MZudu-/- embryos (Fig.2f-g), indicating that MZudu mutants form a bona fide boundary, albeit an irregular one. These results demonstrate that Gon4l is necessary for proper formation of the notochord boundary during gastrulation.
Mediolateral polarity and intercalation of axial mesoderm cells are reduced in MZudu-/- gastrulae
In vertebrate gastrulae, C&E is achieved chiefly through ML intercalation of polarized cells that elongate and align their cell bodies with the ML embryonic axis5, 7, 9, 11. To determine whether cell polarity defects underlie reduced axis extension in Mzudu-/- gastrulae, we measured cell orientation (the angle of a cell’s long axis with respect to the embryo’s ML axis; Fig.3b,e) and cell body elongation (length-to-width or aspect ratio (AR); Fig.3c,f) in confocal time-lapse series of MZudu-/- and WT gastrulae expressing membrane Cherry fluorescent protein (mCherry). Given the irregular notochord boundaries observed in MZudu-/- gastrulae (Fig.2d-e), we examined the time course of cell polarization according to a cell’s position with respect to the boundary: i.e. boundary-adjacent “edge” cells were analyzed separately from those one or two cell diameters away (hereafter −1 and −2, respectively), and so on (See Fig.3). Most WT axial mesoderm cells at 80% epiboly were largely ML oriented and somewhat elongated, but boundary-adjacent “edge” cells were less well oriented (median angle= 24.6°) than cells within any of the internal rows (median angles= 15.7°, 16.6°, 21.1°; Fig.3a-c). However, at the end of the gastrula period 90 minutes later, edge cells became highly aligned and elongated (median angle=13.6°, mean AR=2.2) similar to internal cell rows (median angles= 12.1°, 18.4°; Fig.3a-c). All MZudu-/- axial mesoderm cells exhibited severely reduced ML alignment and elongation at 80% epiboly (Fig.3d-f), but 90 minutes later only the edge cells remained less aligned than WT (median angle=17.0°, mean AR=1.9) (Fig.3e), although aspect ratio of the edge and −1 cells remained reduced (Fig. 3f). These results indicate significantly reduced ML orientation of axial mesoderm cells in MZudu-/- gastrulae, a defect that persisted only in boundary-adjacent cells at late gastrulation. Importantly, this reduction in ML cell polarity was accompanied by significantly fewer cell intercalation events within the axial mesoderm of MZudu mutants compared to WT (Fig.3g-i). As ML intercalation is the key cellular behavior required for vertebrate C&E5, 7, we conclude that this is likely the primary cause of axial mesoderm extension defects in MZudu mutants. We also observed significantly fewer mitoses in MZudu-/- gastrulae (Fig.3j-l). Because decreased cell proliferation and the resulting reduced number of axial mesoderm cells has been demonstrated to impair extension in zebrafish37, this could also be a contributing factor. Together, reduction of ML cell polarity, ML cell intercalations, and cell proliferation provide a suite of mechanisms resulting in impaired axial extension in MZudu-/- gastrulae. Combined with irregular notochord boundaries observed in MZudu mutants, we hypothesize that this boundary provides a ML orientation cue that contributes to ML polarization of axial mesoderm cells, and that this cue is absent or reduced in MZudu-/- gastrulae.
Gon4l regulates axial mesoderm cell polarity and extension independent of PCP signaling
Molecular control of ML cell polarity underlying C&E movements in vertebrate embryos is largely attributed to planar cell polarity (PCP) and Gα12/13 signaling8-12. While zygotic loss of udu enhanced axial extension defects in knym818/m818 PCP mutants (Fig. 1) and axial mesoderm cells in MZudu-/- gastrulae exhibited impaired ML cell polarity and intercalation (Fig.3), it was unclear whether udu functions within or parallel to the PCP network. To address this, we generated compound MZudu;Zknÿfr6/fr6(a nonsense/null kny allele10) mutants utilizing germline replacement as described above. Strikingly, these compound mutant embryos were substantially shorter than single MZudu or knyfr6/fr6 mutants (Fig.4d). Likewise, interference with vangl2/tri function in MZudu mutants by injection of MO1-vangl2 antisense morpholino oligonucleotide38 also exacerbated axis extension defect of MZudu mutants (Supplemental Fig.4a-d). That reduced levels of PCP components kny or tri enhanced short axis phenotype resulting from complete udu deficiency provides evidence that Gon4l affects axial extension via a parallel pathway. Furthermore, expression domains of genes encoding Wnt/PCP signaling components kny, tri, wnt5, and wnt11 in MZudu-/- gastrulae were comparable to WT (Supplemental Fig.4e-l). Finally, we found that the asymmetric intracellular localization of Prickle (Pk)-GFP, a core PCP component, to anterior cell membranes in WT gastrulae during C&E movements32, 39 was not affected in MZudu-/- gastrulae (Fig.4e-f). This is consistent with intact PCP signaling in MZudu mutant gastrulae, and provides further evidence that Gon4l functions largely in parallel to PCP to regulate ML cell polarity and axis extension during gastrulation.
A Gon4l-dependent boundary cue and PCP signaling cooperate to polarize axial mesoderm cells
In addition to PCP signaling, notochord boundaries are required for proper C&E of the axial mesoderm in ascidian embryos40 and are involved in the polarization of intercalating cells during Xenopus gastrulation1. Boundary defects observed in MZudu-/- gastrulae are not a common feature of mutants with reduced C&E, however, as notochord boundaries in knyfr6/fr6 gastrulae were straighter than in WT siblings (Fig.4g). Consistent with cell polarity defects previously reported in kny mutants10, all axial mesoderm cells failed to align ML within kny-/- embryos at 80% epiboly regardless their position relative to the notochord boundary (Fig.4h-j). After 90 minutes, however, kny-/- cells in the edge (and to a lesser extent, −1) position attained distinct ML orientation (median angle= 22.1°). Indeed, the nearer a kny-/- cell was to the notochord boundary, the more ML aligned it was likely to be (Fig.4i). This suggests that the notochord boundary provides a ML orientation cue that is independent of PCP signaling and functions across approximately two cell diameters. Furthermore, this boundary-associated cue appears to operate later in gastrulation, whereas PCP-dependent cell polarization is evident by 80% epiboly. Importantly, distinct cell polarity phenotypes observed in MZudu and kny-/- gastrulae provide further evidence that Gon4l functions in parallel to PCP signaling.
To assess how PCP signaling interacts with the proposed Gon4l-dependent boundary cue, we examined the polarity of axial mesoderm cells in compound zygotic kny-/-;udu-/- mutant gastrulae (Fig.4k-m). As observed in single kny-/- mutant gastrulae10 (Fig.4h-j), both ML orientation and elongation of all axial mesoderm cells were disrupted in double mutants at 80% epiboly, regardless of position with respect to the notochord boundary. By late gastrulation however, edge cells in double mutant gastrulae failed to attain ML alignment as observed in kny-/- mutants, but instead remained largely randomly oriented (median angle= 38.0°) (Fig.4l). This exacerbation of cell orientation defects was correlated with stronger axis extension defects in compound kny-/-;udu-/- compared to single kny-/- mutants (Fig. 1e). This supports our hypothesis that a Gon4l-dependent boundary cue regulates ML alignment of axial mesoderm cells independent of PCP signaling, and that these two mechanisms function in partially overlapping spatial and temporal domains to cooperatively polarize all axial mesoderm cells and promote axial extension.
Loss of Gon4l results in large-scale gene expression changes in zebrafish gastrulae
As a nuclear-localized chromatin factor27, 41 (Supplemental Fig.3j), Gon4l is unlikely to influence morphogenesis directly. To identify genes regulated by Gon4l with potential roles in morphogenesis, we performed RNA sequencing (RNA-seq) in MZudu-/- and WT tailbud-stage embryos. Analysis of relative transcript levels revealed that more than 11% of the genome was differentially expressed (padj<0.01, ≥ 2-fold change) in MZudu mutants (Fig. 5a). Of these ~2,950 differentially expressed genes, 1,692 exhibited increased expression in MZudu compared to 1,259 with decreased expression (Supplemental Table 1). Functional annotation analysis revealed that genes downregulated in MZudu-/- gastrulae were enriched for ontology terms related to chromatin structure, transcription, and translation (Fig.5e), while upregulated genes were enriched for terms related to biosynthesis, metabolism, and protein modifications (Fig.5f). Notably, many of these misregulated genes are considered to have “house-keeping” functions, in that they are essential for cell survival. We further examined genes with plausible roles in morphogenesis, including those encoding signaling and adhesion molecules, and found the majority of genes in both classes were upregulated in MZudu-/- gastrulae (Fig.5c-d). This putative increase in adhesion was of particular interest given the tissue boundary defects observed in MZudu mutants. These findings reveal that although udu is ubiquitously expressed in zebrafish embryos27, its role in regulating gene expression during gastrulation exhibits some specificity for different classes of encoded proteins, many with known or expected roles in morphogenesis during gastrulation.
DamID-seq identifies putative direct targets of Gon4l during gastrulation
To determine genomic loci with which Gon4l protein associates, and thereby distinguish direct from indirect targets of Gon4l regulation, we employed DNA adenine methyltransferase (Dam) identification paired with next generation sequencing (DamID-seq)20, 21. To this end, we generated Gon4l fused to E. coli Dam, which methylates adenine residues within genomic regions in its close proximity20. Small equimolar amounts of RNA encoding a Myc-tagged Gon4l-Dam fusion or a Myc-tagged GFP-Dam control were injected into one-celled embryos, and genomic DNA was collected at tailbud stage (see Material and Methods). In support of this Gon4l-Dam fusion being functional, it localized to the nuclei of zebrafish embryos and partially rescued MZudu embryonic phenotypes (Supplemental Fig.5). Methylated, and therefore Gon4l-proximal, genomic regions were then selected using methylation specific restriction enzymes and adaptors, amplified to produce libraries, and subjected to next generation sequencing. Because Dam is highly active, even an untethered version methylates DNA within open chromatin regions20, and so libraries generated from embryos expressing GFP-Dam served as controls.
Unbiased genome-wide analysis of DamID reads revealed a significant enrichment of Gon4l-Dam over GFP-Dam in promoter regions, and a significant underrepresentation of Gon4l within intergenic regions (Fig.6a). Although no global difference was detected within gene bodies (Fig.6a), examination of individual loci revealed approximately 4,500 genes and over 2,300 promoters in which at least one region was highly Gon4l-enriched (Padj ≤0.01, ≥4-fold enrichment over GFP controls) (Fig.6c-g, Supplemental Table 1). Of these, approximately 1,000 genes were co-enriched for Gon4l in both the promoter and gene body (Fig.6c,g). Levels of Gon4l enrichment across a gene and its promoter were significantly correlated (Supplemental Fig.5f), indicating co-enrichment or co-depletion for Gon4l at both gene features of many loci. Within gene bodies, we found robust enrichment specifically within 5’ untranslated regions (UTRs) (Fig.6b), consistent with association of Gon4l at or near transcription start sites (Fig.6d). Of the ~2,950 genes differentially expressed in MZudu mutants, approximately 28% (812) were also enriched for Gon4l at the gene body (492), promoter (170), or both (150) (Fig.6c-g), and will hereafter be described as putative direct Gon4l targets. histh1, for example, was among the most downregulated genes by RNA-seq in MZudu mutants and was highly enriched for Gon4l at both its promoter and gene body (Fig.6c). By contrast, tbx6 expression was also reduced in MZudu mutants, but exhibited no enrichment of Gon4l over GFP controls (Fig.6d). Approximately 35% and 53% of genes enriched for Gon4l in only the gene body or only the promoter, respectively, were positively regulated (i.e. downregulated in MZudu mutants), as were 50% of genes co-enriched at both features. Furthermore, among these positively regulated genes, differential expression levels (the degree to which WT expression exceeded MZudu) correlated positively and significantly with Gon4l enrichment levels across both gene bodies and promoters (Fig.6h). A similar correlation was not observed for negatively regulated genes, hence, the highest levels of Gon4l enrichment were associated with positive regulation of gene expression. These results implicate Gon4l as both a positive and negative regulator of gene expression during zebrafish gastrulation.
Gon4l regulates notochord boundary straightness by limiting epcam and itga3b expression
We next examined our list of putative direct Gon4l target genes for those with potential roles in tissue boundary formation and/or cell polarity. The epcam gene, which encodes Epithelial cell adhesion molecule (EpCAM), stood out because it was not only enriched for Gon4l by DamID (Fig.7a) and upregulated in MZudu-/- gastrulae (Fig.7c), but was also identified in a Xenopus overexpression screen for molecules that disrupt tissue boundaries42. Furthermore, EpCAM negatively regulates Cadherin-based adhesion43, 44 and non-muscle Myosin activity45, making it a compelling candidate. We also chose to examine itga3b, which encodes Integrinα3b, because as a component of a Laminin receptor46, it is an obvious candidate for molecules involved in formation of a tissue boundary at which Laminin is highly enriched (Fig.2f). itga3b expression was increased in MZudu-/- gastrulae by both RNA-seq and qRT-PCR (Fig. 7d), and DamID revealed a region within the itga3b promoter at which Gon4l was highly enriched (Fig. 7b-b’). We found that overexpression of either epcam or itga3b by RNA injection into WT embryos recapitulated some aspects of the MZudu-/- gastrulation phenotype, including irregular notochord boundaries (Fig.7e) and reduced ML orientation and elongation of axial mesoderm cells (Fig.7h-m). Conversely, injection of a translation-blocking itga3b MO (MO1-itga3b47) at a dose phenocopying the fin defects of itga3b mutants47 (Supplemental Fig.6b) significantly improved boundary straightness in MZudu mutants compared with control injected siblings (Fig.7f). However, injection of an epcam MO (MO2-epcam48) at a dose phenocopying the loss of otoliths in epcam mutants48 (Supplemental Fig.6d) did not suppress boundary defects in MZudu mutants (Fig.7g), indicating that excess itga3b is largely responsible for irregular notochord boundaries in MZudu-/- gastrulae. To determine whether excess itga3b was sufficient to phenocopy the kny-/-;udu-/- double mutant phenotype identified in our synthetic screen (Fig.1), we overexpressed itga3b in kny-/- embryos and found that it exacerbated the short axis phenotype of these PCP mutants at 24hpf (Fig.7n-p), an effect not produced by injection of control GFP RNA. Together, these results indicate that negative regulation of itga3b and epcam expression by Gon4l contributes to proper notochord boundary formation in zebrafish gastrulae. Interestingly, ML cell polarity defects were not suppressed in MZudu-/- embryos injected with itga3b (or epcam) MO compared to control injected mutant siblings (Supplemental Fig.6e-p), despite the improvement in boundary straightness. This implies that Gon4l has boundary-dependent and independent roles in cell polarization, and that additional gene expression changes likely contribute to this aspect of the mutant phenotype.
Tissue tension is reduced at the notochord boundary of MZudu embryos
In WT zebrafish and Xenopus embryos, the notochord boundary straightens over time (Fig.2e) and accumulates myosin49, implying that it is under tension. Mechanical forces within the embryo (like tension) can instruct specific cell behaviors such as polarization, intercalation, and PCP protein localization50-54, and we hypothesized that increased notochord boundary tension may act as an instructive cell polarity cue that is reduced in MZudu-/- gastrulae. We therefore laser-ablated interfaces between axial mesoderm cells in live WT and MZudu-/- gastrulae and recorded recoil of adjacent cell vertices as a measure of tissue tension55, 56 (Fig.8a-b). Cell interfaces were classified according to convention described in (55, 57) as V junctions (actively shrinking to promote cell intercalation), T junctions (not shrinking) or Edge junctions (falling on and thus comprising the notochord boundary). We found that recoil distances at WT Edge junctions were significantly greater than that of WT V (p=0.0001) or T junctions (p=0.0026), demonstrating that the notochord boundary is under greater tension than the rest of the tissue (Fig.8c-e). Consistent with our hypothesis, recoil distance was significantly smaller in MZudu-/- than in WT gastrulae for all classes of junctions (Fig.8c-e), and this decrease was largest and most significant in Edge junctions, especially at 80% epiboly (Fig.8c). These results point to reduced tension as a possible cause of notochord boundary and cell polarity defects in MZudu mutants. Because excess epcam and itga3b were sufficient to disrupt notochord boundaries and ML cell polarity (Fig.7), we next tested whether epcam and itga3b overexpression could likewise affect boundary tension. Injection of WT embryos with epcam RNA was sufficient to disrupt tissue tension at the notochord boundary and throughout the axial mesoderm (Fig.8c-e). Curiously, although we found itga3b to be largely causative of boundary irregularity in MZudu mutants (Fig.7), its overexpression did not consistently produce a similar reduction in tension (Fig.8c-e). Together these results implicate excess EpCAM and Integrinα3b as key molecular defects underlying reduced boundary tension and reduced boundary straightness, respectively, observed in MZudu-/- gastrulae. We propose a model whereby Gon4l negatively regulates expression of these adhesion molecules to ensure proper formation of the notochord boundary, which together with additional boundary-independent roles of Gon4l cooperates with PCP signaling to promote ML cell polarity underlying C&E gastrulation movements (Fig.8f).
DISCUSSION
Significant advances have been made in defining signaling pathways instructing gastrulation cell behaviors that shape the vertebrate body plan, but epigenetic control of these morphogenetic processes remains largely unexplored. Here we have described the conserved chromatin factor Gon4l as a regulator of polarized cell behaviors underlying axis extension during zebrafish gastrulation. We identified a large number of genes regulated by Gon4l, including many genes with known or predicted roles in morphogenesis, and linked misregulation of a subset of them to specific morphogenetic cell behaviors. Because Gon4l does not bind DNA directly, we predict that Gon4l-enriched genomic loci are direct targets of chromatin modifying protein complexes with which Gon4l associates41. Only a fraction of the thousands of Gon4l-enriched genes and promoters exhibited corresponding changes in gene expression during gastrulation, which may reflect the following: 1) Gon4l may not alter expression of all loci with which it associates, 2) loci recently occupied by Gon4l may not yet reflect changes in transcript levels, and 3) because DamID provides a “history” of Gon4l association, our experiment revealed both past and currently occupied loci. We also identified loci at which Gon4l was depleted compared to GFP-Dam controls (Supplemental Fig.5), and speculate they represent open chromatin regions with which Gon4l does not associate. Surprisingly, although a larger number of putative Gon4l direct target genes were negatively regulated (i.e. upregulated in MZudu mutants), the highest levels of Gon4l enrichment correlated with positive regulation of gene expression (Fig.6). This demonstrates that Gon4l does not act strictly as a negative regulator of gene expression, a role assigned to it based on in vitro evidence and thought to be mediated by its interactions with Histone deacetylases41. Our data instead indicate that Gon4l acts as both a positive and negative regulator of gene expression during zebrafish gastrulation, implying context-specific interactions with multiple epigenetic regulatory complexes.
Phenotypes caused by complete udu deficiency are conspicuously pleiotropic, but our studies point to remarkably specific roles for udu in gastrulation morphogenesis. Loss of udu function reduced tissue extension without impairment of other gastrulation movements, including mesendoderm internalization, epiboly, prechordal plate migration, and convergence (see below). Moreover, the dorsal gastrula organizer and all three germ layers were specified (Fig. 1, Supplemental Fig.2), indicating that MZudu mutants do not suffer from a general delay or arrest of development; rather Gon4l regulates a specific subset of gastrulation cell behaviors including ML cell polarity and intercalation in the axial mesoderm. Importantly, the role of Gon4l in these processes is independent of PCP signaling as supported by several lines of evidence, including distinct morphogenetic defects in PCP versus MZudu mutants. Whereas PCP mutants exhibit reduced convergence movements9, 10, 14, evidenced by a larger number of cell rows in kny-/- axial mesoderm (Fig.4), the axial mesoderm of MZudu mutants contained a normal number of cell rows (Fig.3), indicating no obvious convergence defect. We also observed an intact notochord boundary in PCP mutants, as well as boundary-associated cell polarity (Fig.4). Despite these apparently parallel functions, expression of some PCP genes, including wnt11, wnt11r, prickle1a, prickle1b, celsr1b, celsr2, and fzd2 are regulated by Gon4l as revealed by RNA-seq and DamID-seq experiments (Supplemental Table 1). However, functional redundancies within the PCP network58, 59 likely allow for intact PCP signaling in MZudu mutants despite misregulation of some PCP genes. Notably, gastrula morphology and cell polarity defects in MZudu mutants were also distinct from ventralized and dorsalized patterning mutants that exhibit abnormal C&E13, 15, 60.
Modulation of adhesion at tissue boundaries has been implicated as a driving force of cell intercalation49, 61, and indeed genes annotated as encoding adhesion molecules tended to be expressed at higher levels in MZudu-/- gastrulae (Fig.5). Two of these, itga3b and epcam, exhibited increased expression in MZudu-/- gastrulae by RNA-seq and qRT-PCR, were identified as putative direct Gon4l targets by DamID (Fig.7), and were each sufficient to disrupt notochord boundary straightness and ML cell orientation and elongation when overexpressed in WT embryos (Fig.7). Furthermore, decreasing levels of Integrinα3b (but not EpCAM) improved boundary straightness in MZudu mutants (Fig.7), while overexpression of epcam (but not itga3b) was sufficient to reduce tissue tension at the notochord boundary of WT embryos (Fig.8). These observations suggest that excesses of each of these molecules contribute to overlapping and distinct cellular defects. In Xenopus gastrulae, EpCAM negatively regulates non-muscle Myosin contractility45, and experimental perturbation of Myosin activity disrupts notochord boundary formation49. Myosin accumulation also increases tension at tissue boundaries62, 63, which biases cell intercalations52, 54. This likely explains why excess epcam was sufficient to disrupt boundary tension and straightness in WT embryos, although modulation of Integrin-mediated cell-matrix adhesion at the notochord boundary was also necessary to cause MZudu boundary phenotypes. Notably, restoration of boundary straightness in MZudu-/- gastrulae was not sufficient to improve ML cell orientation. This could reflect at least two possibilities: 1) the suppression of boundary phenotypes by the itga3b MO was partial and therefor not sufficient to fully restore the boundary-associated cell polarity signal; or 2) the boundary-associated polarity signal was restored, but MZudu-/- axial mesoderm cells were unable to respond to it. Either of these scenarios assumes that additional gene expression changes contribute to reduced ML cell polarity in MZudu mutants, and indeed, several other candidate genes with plausible or known roles in C&E and/or boundary formation were also misregulated in MZudu-/- gastrulae. For example, epha7, which encodes an Eph receptor, a class of signaling molecules with well-described roles in tissue boundary formation64, was expressed at reduced levels in MZudu mutants. Expression of daam1, which encodes a critical link between PCP signaling and Actomyosin contractility65, and genes encoding several Myosin light and heavy chain isoforms were also reduced in MZudu mutants (Supplemental Table 1). In addition to excess itga3b and epcam expression, misregulation of these molecules could also contribute to impaired ML cell polarity in MZudu-/- gastrulae.
In this study of zebrafish Gon4l, we have begun to dissect the logic of epigenetic regulation of gastrulation morphogenesis, and revealed a key role for this chromatin factor in limiting expression of specific genes during gastrulation. This role has important developmental implications, as C&E gastrulation movements are sensitive to both gain and loss of gene function9, 12. We propose that by negatively regulating Integrinα3b and EpCAM levels, Gon4l promotes development of the anteroposteriorly aligned notochord boundary and influences ML polarity and intercalation of axial mesoderm cells. In cooperation with PCP signaling, this cue coordinates ML cell polarity with embryonic patterning to drive anteroposterior embryonic axis extension (Fig.8f).
AUTHOR CONRIBUTIONS
M.W., A.S., and L.S.K. designed the study. M.W., A.S., and T.B. performed experiments. C.Y. participated in the initial forward genetic screen. P.G. performed bioinformatic analysis. M.W. and L.S.K. wrote the manuscript. National Institutes of Health grants R01GM55101 and R35GM118179 to L.S.K. and F32GM113396 to M.W., and a W.M. Keck Foundation Fellowship to M.W. in part supported this study.
METHODS
Zebrafish strains and embryo staging
Adult zebrafish were raised and maintained according to established methods66 in compliance with standards established by the Washington University Animal Care and Use Committee. Embryos were obtained from natural mating and staged according to morphology as described67. All studies on WT were carried out in AB* or AB*/Tübingen backgrounds. Additional lines used include knym818, knyfr6 10, udusq1 27, and uduvu66 (this work). Embryos of these strains generated from heterozygous intercrosses were genotyped by PCR after completion of each experiment. Germline replaced fish were generated by the method described in (33). Briefly, donor embryos from uduvu66/+ intercrosses or females with uduvu66/vu66 germline were injected with synthetic RNA encoding GFP-nos1-3’UTR 68, and WT host embryos were injected with a morpholino oligonucleotide against dead end1 (MO1-dnd1)33 to eliminate host germ cells. Cells were transplanted from the embryonic margin of donor blastulae to the embryonic margin of hosts at sphere stage, and both hosts and donors were cultured in agarose-coated plates. Host embryos were screened for GFP+ germ cells at 36-48 hpf, and the genotype of corresponding donors was determined by phenotype. All putative uduvu66/vu66 germline hosts were raised to adulthood and confirmed by crossing to uduvu66/+ animals prior to use in experiments.
Synthetic mutant screening
WT male fish were mutagenized by the chemical mutagen N-ethyl-N-nitrosourea (ENU) as described 22, then outcrossed to WT females to produce F1 families. F2 families were obtained by crossing F1 fish with fish homozygous for the hypomorphic knypek allele knym818 (rescued by injection with synthetic kny WT RNA). F3 embryos obtained from F2 cross were screened by morphology at 12 and 24hpf to identify recessive enhancers of the knym818/m818 short axis mutant phenotype10.
Positional cloning
We employed the positional cloning approach using a panel of CA simple-sequence length polymorphism markers representing 25 linkage groups25 to map the vu66 mutation to chromosome 16 between the markers of z17403 and z15431. Given phenotypic similarities between vu66/vu66 and the udusq1/sq1 mutant phenotype27, we sequenced udu cDNA from 24hpf vu66/vu66 mutant embryos revealing a T2261A transversion that is predicted to create Y753STOP nonsense mutation. We designed a dCAPS69 marker for the vu66 mutation and confirmed that no recombination occurred in 810 vu66/vu66 homozygous embryos.
Microinjection
One-celled embryos were aligned within agarose troughs generated using custom-made plastic molds and injected with 1-3 pL volumes using pulled glass needles. Synthetic mRNAs for injection were made by in vitro transcription from linearized plasmid DNA templates using Invitrogen mMessage mMachine kits. Doses of RNA per embryo were as follows: 100pg membrane Cherry, 50pg membrane GFP, 25pg udu-gfp, 200pg epcam, 200pg itga3b, 1pg gfp-dam-myc, 3pg udu-dam-myc for DamID experiments, 20pg gfp-dam-myc for MZudu rescue, and 150pg GFP-nos1-3’UTR for germline transplantation. To assess Pk-GFP localization, embryos were injected at one cell stage with membrane Cherry RNA, then injected with 15pg Drosophila prickle-GFP and 20pg H2B-RFP RNAs into a single blastomere at 16-cell stage as described32, 39. Injections of MOs were carried out as for synthetic RNA. Doses of MOs per embryo were as follows: 3ng MO1-dnd1 33, 4ng MO1-tri/vangl2 38, 1ng MO2-epcam48, 2ng MO1-itga3b47.
Whole-mount in situ hybridization
Antisense riboprobes were transcribed using NEB T7 or T3 RNA polymerase and labeled with digoxygenin (DIG) (Roche). Whole-mount in situ hybridization (WISH) was performed as described 70.
Immunofluorescent staining
Embryos were fixed in 4% paraformaldehyde (PFA) in phosphate buffered saline (PBS), rinsed in PBS + 0.1% tween (PBT), digested briefly in 10 mg/mL proteinase K, re-fixed in 4% PFA, rinsed in PBT, and blocked in 2 mg/mL bovine serum albumin + 2% goat serum in PBT. Embryos were then incubated overnight in rabbit anti-Laminin (Sigma L9393) at 1:200, mouse anti-Myc (Cell Signaling 2276) at 1:1000, or rabbit anti-phospho Histone H3 (Upstate 06-570) at 1:500 in blocking solution, rinsed in PBT, and incubated overnight in Alexa Fluor 488 anti-Rabbit IgG, 568 anti-Rabbit, or 568 anti-Mouse (Invitrogen) at 1:1000 in PBT. Embryos were costained with 4’,6-Diamidino-2-Phenylindole, Dihydrochloride (DAPI) and rinsed in PBT prior to mounting in agarose for confocal imaging.
TUNEL staining
Terminal deoxynucleotidyl transferase (TdT) dUTP Nick-End Labeling (TUNEL) staining to detect apoptosis was carried out according to the instructions for the ApopTag Peroxidase in situ apoptosis detection kit (Millipore) with modifications. Briefly, embryos were fixed in 4% PFA, digested with 10 μg/mL proteinase K, refixed with 4%PFA, and post-fixed in chilled ethanol:acetic acid 2:1, rinsing in PBT after each step. Embryos were incubated overnight with TdT and rinsed in stop/wash buffer, then blocked, incubated with anti-DIG antibody, and stained in Roche BM Purple staining solution.
Microscopy
Live embryos expressing fluorescent proteins or fixed embryos subjected to immunofluorescent staining were mounted in 0.75% low-melt agarose in glass bottomed 35-mm petri dishes for imaging using a modified Olympus IX81 inverted spinning disc confocal microscope equipped with Voltran and Cobolt steady-state lasers and a Hamamatsu ImagEM EM CCD digital camera. For live time-lapse series, 60 μm z-stacks with a 2μm step were collected every three or ten minutes (depending on the experiment) for three hours using a 40x dry objective lens. Embryo temperature was maintained at 28.5°C during imaging using a Live Cell Instrument stage heater. When necessary, embryos were extracted from agarose after imaging for genotyping. For immunostained embryos, 200 μm z-stacks with a 1 or 2μm step were collected using a 10x or 20x dry objective lens, depending on the experiment. Bright field and transmitted light images of live embryos and in situ hybridizations were collected using a Nikon AZ100 macroscope.
Laser ablation tension measurements
Embryos were injected at one cell stage with mCherry mRNA and mounted at 80% epiboly for imaging (as described above) on a Zeiss 880 Airyscan 2-photon inverted confocal microscope. An infrared laser tuned to 710 nm was used to ablate fluorescently labeled cell interfaces, immediately followed by a quick time-lapse series of ten images with no interval to record recoil after each ablation event. Images were collected using a 40x water immersion objective lens, and a Zeiss stage heater was used to maintain embryo temperature at 28.5°C. Approximately 8-12 cell interfaces were ablated per embryo, and no fewer than 32 embryos per genotype from no fewer than four independent experiments were analyzed due to high variability of recoil distances. Image series were analyzed using ImageJ to determine the inter-vertex distance of each cell interface prior to and immediately after ablation and used to calculate recoil distance.
Image analysis
ImageJ was used to visualize and manipulate all microscopy data sets. For immunostained embryos, multiple z-planes were projected together to visualize the entire region of interest. For live embryo analysis, a single z-plane through the length of the axial mesoderm was chosen for each time point. When possible, embryo images were analyzed prior to genotyping. Cell polarity was analyzed in no fewer than six live embryos per genotype due to high variability of these measurements. To measure cell orientation and elongation, the anteroposterior axis in all embryo images was aligned prior to manual outlining of cells. A fit ellipse was used to measure orientation of each cell’s major axis and its aspect ratio. The TissueAnalyzer ImageJ package71 was used to automatically segment time-lapse series of axial mesoderm and detect T1 transitions. Boundary straightness was measured by manually tracing the notochord boundary to determine total length, then dividing it by the length of a straight line connecting the ends of the boundary (net length). To assess Pk-GFP localization, isolated cell expressing Pk-GFP were scored according to whether GFP was present in puncta localized to the anterior side of the cell, in puncta localized elsewhere, or in the cytoplasm. Pk-GFP localization was analyzed in multiple cells from each of no fewer than three embryos per genotype.
Quantitative RT-PCR
Total RNA was isolated from tailbud stage WT and MZudu-/- embryos homogenized in Trizol (Life Technologies), 1μg of which was used to synthesize cDNA using the iScript kit (BioRad) following manufacturer’s protocol. SYBR green (BioRad) qRT-PCR reactions were run in a CFX Connect Real-Time PCR detection system (BioRad). Primers used are as follows:
epcam: F- TGAGGACGGGGATTGAGAAC
R- GAGCCTGCCATCCTTGTCAT
itga3b: F- CCGGTGTTGGGAGAAGAGAC
R- CTTGAAGAAACCACACGAAGGG
EF1a: F- CTGGAGGCCAGCTCAAACAT
R- ATCAAGAAGAGTAGTACCGCTAGCATTAC
Rpl13a: F- TCTGGAGGACTGTAAGAGGTATGC
R- AGACGCACAATCTTGAGAGCAG
RNA sequencing and analysis
RNA for sequencing was isolated from 50 WT or MZudu embryos per sample at tailbud stage according to instructions for the Dynabeads mRNA direct kit (Ambion). Embryos from two clutches per genotype (e.g. WT A & B) were collected, then divided in two (e.g. WT A1, A2, B1, and B2) to yield four independently prepared libraries representing two biological and two technical replicates per genotype. Libraries for were prepared according to instructions for the Epicentre ScriptSeq v2 RNA-seq Library preparation kit (Illumina). Briefly, RNA was enzymatically fragmented prior to cDNA synthesis. cDNA was then 3’ tagged, purified using Agencourt AMPure beads, and PCR amplified, at which time sequencing indexes were added. Indexed libraries were then purified and submitted to the Washington University Genome Technology Access Center (GTAC) for sequencing using an Illumina HiSeq 2500 to obtain single-ended 50bp reads. Raw reads were mapped to the zebrafish GRCz10 reference genome using STAR (2.4.2a)72 with default parameters. FeatureCounts (v1.4.6) from the Subread package73 was used to quantify the number of uniquely mapped reads (phred score≥10) to gene features based on the Ensembl annotations (v83). Significantly differentially expressed genes were determined by using DESeq2 in the negative binomial distribution model74 with a cutoff of adjusted p-value≤0.01 and fold-change≥2.0. Heatmaps were built using the heatmaps2 package in R, and other plots were built using the ggplot2 package in R.
DamID-seq
E. coli DNA adenine methyltransferase (EcoDam) was cloned from the pIND(V5)EcoDam plasmid21 (a kind gift from Dr. Bas Van Steensel, Netherlands Cancer Institute) by Gibson assembly into a 3’ Gateway entry vector containing 6 Myc tags and an SV40 polyA signal (p3E-MTpA). The resulting p3E-EcoDam-MTpA vector was then Gateway cloned into PCS2+ downstream of udu cDNA or eGFP to produce C terminal fusions. The resulting udu-dam-myc and gfp-dam-myc plasmids were linearized by Kpnl digestion and transcribed using the mMessage mMachine SP6 in vitro transcription kit (Ambion). WT AB* embryos were injected at one cell stage with 3pg mRNA encoding Gon4l-Dam-Myc or with 1pg encoding GFP-Dam-Myc as controls. The remainder of the protocol was carried out largely as in (21) with modifications. Genomic (g)DNA was collected at tailbud stage using a Qiagen DNeasy kit with the addition of RNAse A. gDNA was digested with Dpnl overnight, followed by ligation of DamID adaptors. Un-methylated regions were destroyed by digestion with DpnII, and then methylated regions were amplified using primers complementary to DamID adaptors. Two identical 50μl PCR reactions were performed and pooled for each sample to reduce amplification bias, and three biological replicates were collected per condition. Amplicons were purified using a Qiagen PCR purification kit, then digested with DpnII to remove DamID adaptors. Finally, samples were purified using Agencourt AMPure XP beads and submitted for library preparation and sequencing at the Washington University GTAC using an Illumina HiSeq 2500 to obtain single-ended 50bp reads.
Analysis of DamID-seq data
Raw reads were aligned to zebrafish genome GRCz10 by using bwa mem (v0.7.12) with default parameters75, then sorted and converted into bam format by using SAMtools (v1.2)76. The zebrafish genome was divided into continuous 1000bp bins, and FeatureCounts (v1.4.6) from the Subread package73 was used to quantify the number of uniquely mapped reads (phred score ≥10) in each bin. Significantly differentially Gon4l-associated bins were determined by using DESeq2 in the negative binomial distribution model74 with stringent cutoff: adjusted p-value≤0.01 and fold-change ≥4.0. Promoter regions were defined as 2kb upstream of the transcription start site of a gene based on Ensembl annotations (v83). Wiggle and bigwig files were created from bam files using IGVtools (v2.3.60) (https://software.broadinstitute.org/software/igv/igvtools) and wigToBigWig (v4)77, respectively. BigWig tracks were visualized using IGV (v2.3.52)78.
Data Availability
Processed RNA-seq and DamID-seq data are available in Supplemental Table1 of this publication, and raw data have been deposited in the Gene Expression Omnibus (GEO) with the following accession numbers: RNA-seq: GSE96575 https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=ipwzmaoqjpajbqd&acc=GSE96575 DamID-seq: GSE96576 https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=apkloooyvxsjxij&acc=GSE96576
Statistical analysis
Graphpad Prism 6 and 7 software was used to perform statistical analyses and generate graphs of data collected from embryo images. The statistical tests used varied as appropriate for each experiment and are described in the text and figure legends. All tests used were two-tailed. Differential expression and differential enrichment analysis of RNA and DamID sequencing data were completed as described above. Panther79 was used to classify differentially expressed genes and to produce pie charts; DAVID Bioinformatic Resources80 was used for functional annotation analysis.
Subcloning
The full-length udu open reading frame was subcloned from cDNA using following primers:
udu cacc F1: CACCATGGGATGGAAACGCAAGTCTTC
udu TGA R: TCAGTCCTGCTCTTCATCAGTGGC
udu R: GTCCTGCTCTTCATCAGTGGCCGAC
udu cDNAs with or without a stop codon were cloned into the pENTR/D-TOPO (Thermo Fisher) vector, which were then Gateway cloned into PCS2+ upstream of polyA signal or eGFP to produce a C terminal fusion. The full-length epcam open reading frame was subcloned from WT cDNA using the following primers:
epcam F: GGATCCCATCGATTCGATGAAGGTTTTAGTTGCCTTG
epcam R: ACTCGAGAGGCCTTGTTAAGAAATTGTCTCCATCTC
The 5’ portion of the itga3b open reading frame was cloned from WT cDNA, and the 3’ portion was cloned from a partial cDNA clone (GE/Dharmacon) using the following primers:
5’tga3bF: TGCAGGCGCGCCGGATCCCATCGATTCGATGGCCGGAAAGTCTCTG
5’ itga3b R: ATTT GAGTGAGTAT GGAAT G G AGATGTT GAGCG
3’ itga3b F: TCAACATCTCCATTCCATACTCACTCAAATACTCAGG
3’ itga3b R: GTTCTAGAGGTTTAAACT CGAGAGGCCTTGTCAGAACT CCTCCGT CAG
The resulting amplicons were Gibson cloned81 into PJS2 (a derivative of PCS2+) linearized with EcoRI.
ACKNOWLEDGEMENTS
We thank Dr. Bas Van Steensel for EcoDam plasmids, Drs. Christine and Bernard Thisse for WISH probes, Dr. Bo Zhang and Dr. Scott Higdon for bioinformatics help, Dr. Matthew Hass for DamID advice, Bisiayo Fashemi for assistance with image analysis, and the Washington University Genome Technology Access Center for library preparation and sequencing services.
REFERENCES
- 1.↵
- 2.
- 3.
- 4.↵
- 5.↵
- 6.
- 7.↵
- 8.↵
- 9.↵
- 10.↵
- 11.↵
- 12.↵
- 13.↵
- 14.↵
- 15.↵
- 16.↵
- 17.↵
- 18.
- 19.↵
- 20.↵
- 21.↵
- 22.↵
- 23.↵
- 24.↵
- 25.↵
- 26.↵
- 27.↵
- 28.↵
- 29.↵
- 30.↵
- 31.↵
- 32.↵
- 33.↵
- 34.↵
- 35.↵
- 36.↵
- 37.↵
- 38.↵
- 39.↵
- 40.↵
- 41.↵
- 42.↵
- 43.↵
- 44.↵
- 45.↵
- 46.↵
- 47.↵
- 48.↵
- 49.↵
- 50.↵
- 51.
- 52.↵
- 53.
- 54.↵
- 55.↵
- 56.↵
- 57.↵
- 58.↵
- 59.↵
- 60.↵
- 61.↵
- 62.↵
- 63.↵
- 64.↵
- 65.↵
- 66.↵
- 67.↵
- 68.↵
- 69.↵
- 70.↵
- 71.↵
- 72.↵
- 73.↵
- 74.↵
- 75.↵
- 76.↵
- 77.↵
- 78.↵
- 79.↵
- 80.↵
- 81.↵