Summary
The rice XA21-mediated immune response is activated upon recognition of the RaxX peptide produced by the bacterium Xanthomonas oryzae pv. oryzae (Xoo). The 60 residue RaxX precursor is posttranslationally modified to form a sulfated tyrosine peptide that shares sequence and functional similarity with the plant sulfated tyrosine (PSY) peptide hormones. The five kb raxX-raxSTAB gene cluster of Xoo encodes RaxX, the RaxST tyrosylprotein sulfotransferase, and the RaxA and RaxB components of a predicted type one secretion system. The identified the complete raxX-raxSTAB gene cluster is present only in Xanthomonas spp., in five distinct lineages in addition to X. oryzae. The phylogenetic distribution of the raxX-raxSTAB gene cluster is consistent with the occurrence of multiple lateral transfer events during Xanthomonas speciation. RaxX variants representing each of the five lineages, and three Xoo RaxX variants, fail to activate the XA21-mediated immune response yet retain peptide hormone activity. These RaxX variants contain a restricted set of missense mutations, consistent with the hypothesis that selection acts to maintain peptide hormone-like function. These observations are also consistent with the hypothesis that the XA21 receptor evolved specifically to recognize Xoo RaxX.
INTRODUCTION
Host receptors activate innate immunity pathways upon pathogen recognition (Ronald & Beutler, 2010). The gene encoding the rice XA21 receptor kinase (Song et al., 1995) confers resistance against most strains of the gamma-proteobacterium Xanthomonas oryzae pv. oryzae (Xoo) (Wang et al., 1996). This well-studied XA21-Xoo interaction provides a basis from which to understand molecular and evolutionary mechanisms of host-microbe interactions.
Four Xoo genes that are required for activation of XA21-mediated immunity, are located in the raxX-raxSTAB gene cluster (Fig. 1). The 60-residue RaxX predicted precursor protein undergoes sulfation by the RaxST tyrosylprotein sulfotransferase at residue Tyr-41 (Pruitt et al., 2015). We hypothesize that the RaxB proteolytic maturation and ATP-dependent peptide secretion complex (da Silva et al., 2004) further processes the sulfated RaxX precursor by removing its double-glycine leader peptide prior to secretion (Holland et al., 2016). Located outside the raxX-raxSTAB gene cluster, the raxC gene, an ortholog of the tolC gene, encodes the predicted outer membrane channel for this secretion complex (da Silva et al., 2004). Finally, the raxPQ genes encode enzymes to assimilate sulfate into 3’-phosphoadenosine 5’-phosphosulfate (PAPS) (Shen et al., 2002), the sulfodonor for the RaxST sulfotransferase (Han et al., 2012).
In both plants and animals, the post-translational modification catalyzed by tyrosylprotein sulfotransferase is restricted to a subset of cell surface and secreted proteins that influence a variety of eukaryotic physiological processes (Matsubayashi, 2014, Stone et al., 2009). For example, tyrosine sulfation of the chemokine receptors CCR5 and CXCR4 is essential for their functions including as coreceptors for the human immunodeficiency virus gp120 envelope glycoprotein (Farzan et al., 1999, Kleist et al., 2016). In plants, sulfated tyrosine peptides influence cellular proliferation and expansion in root growth, and/or plant immune signaling (Matsubayashi, 2014, Tang et al., 2017). In contrast to these and other examples of protein tyrosine sulfation in animals and plants, RaxX sulfation by the RaxST enzyme is the only example of tyrosine sulfation documented in bacteria (Pruitt et al., 2015, Han et al., 2012).
Mature RaxX is predicted to comprise the carboxyl-terminal residues 40-60, numbered according to the precursor protein (Pruitt et al., 2015, Pruitt et al., 2017). RaxX residues 40-52 share sequence similarity with mature plant peptide containing sulfated tyrosine (PSY) hormones (Pruitt et al., 2015, Amano et al., 2007, Pruitt et al., 2017). RaxX, like PSY1, can enhance root growth in diverse plant species (Pruitt et al., 2017). The XA21-mediated response in rice requires residues 40-55 (RaxX16 peptide), whereas plant growth stimulation requires only residues 40-52 (RaxX13 peptide) (Pruitt et al., 2015). Fig. 2 shows sequences for the RaxX variants examined in this study, together with two representative PSY sequences for comparison.
RaxX sequences generally are well conserved within different Xanthomonas species (Pruitt et al., 2017). In Xoo however, RaxX from a strain IXO685, which evades XA21-mediated immunity differs from active RaxX at the critical positions Pro-44 and Pro-48 (Fig. 2) (Pruitt et al., 2015). Nevertheless, this RaxX protein stimulates root growth, as do two other RaxX Pro-48 variants from other Xanthomonas spp. (Fig. 6 in (Pruitt et al., 2017)).
These results suggest that RaxX recognition by XA21 is restrained by different sequence and length requirements compared to its recognition by the root growth promoting receptor(s) for PSY hormone(s). It also suggests that recognition of RaxX by XA21 is specific to Xoo, whereas PSY mimicry is a general feature of RaxX from other Xanthomonas spp. Accordingly, we hypothesized that PSY hormone mimicry is the original function of RaxX, whereas immune recognition by XA21 evolved later in response to Xoo (Pruitt et al., 2017).
Two general predictions derive from this hypothesis. The first prediction, that PSY hormone mimicry is broadly selective, is supported here by the presence of the raxX-raxSTAB gene cluster Xanthomonas spp., and by the ability of all RaxX variants tested to stimulate root growth in an assay for PSY function. The second prediction, that recognition by XA21 is restricted to X. oryzae lineages, is validated here by the observation that XA21-mediated immunity is not activated by RaxX variants from other Xanthomonas spp. These results illustrate how a pathogen protein has evolved to retain its ability to modulate host physiology without being recognized by the host immune system.
RESULTS
The raxX-raxSTAB gene cluster is present in a subset of Xanthomonas spp
We searched databases at the National Center for Biotechnology Information to identify bacterial genomes with the raxX-raxSTAB gene cluster. We found the intact raxX-raxSTAB gene cluster exclusively in Xanthomonas spp., and ultimately detected it in more than 200 unique genome sequences (File. S1) among 413 accessed through the RefSeq database (O’Leary et al., 2016).
Xanthomonas taxonomy has undergone several changes over the years (Vauterin et al., 2000, Young, 2008) (see (Midha & Patil, 2014) for a representative example). At one point, many strains were denoted as pathovars of either X. campestris or X. axonopodis, but today over 20 species are distinguished, several with multiple pathovars (Rademaker et al., 2005, Vauterin et al., 1995). Because many of the genome sequences we examined are from closely-related strains, in some cases associated with different species designations, we constructed a whole-genome phylogenetic tree as described in Materials and Methods in order to organize these sequences by relatedness (Fig. S1). The topology of the resulting tree shares broad similarity with several other Xanthomonas phylogenetic trees in defining relationships between well-sampled species (Midha & Patil, 2014, Rademaker et al., 2005, Hauben et al., 1997, Parkinson et al., 2007, Parkinson et al., 2009, Ferreira-Tonin et al., 2012, Gardiner et al., 2014, Triplett et al., 2015, Young, 2008).
To examine raxX-raxSTAB gene cluster organization and inheritance more closely, we selected 15 genomes from strains that represent the phylogenetic range of Xanthomonas spp. (Table 1 and Fig. S1). Where possible, we chose complete genome sequences that are accompanied by published descriptions. Throughout the analyses described below, species for which relatively large numbers of sequences are available also were monitored broadly for exceptional features. The close relative Stenotrophomonas maltophilia, which does not contain the raxX-raxSTAB gene cluster, serves as the outgroup (Moore et al., 1997).
To facilitate discussion, we represent phylogenetic relationships between these strains as a cladogram that emphasizes relative positions of the raxX-raxSTAB gene cluster-positive lineages (Fig. 3). Six distinct Xanthomonas lineages contain the raxX-raxSTAB gene cluster, one being X. oryzae. A second lineage includes related strains currently denoted as X. vasicola or X. campestris pv. musacearum (Aritua et al., 2008); for concise presentation, we refer to these collectively as X. vasicola. The third lineage includes X. euvesicatoria and related species (Rademaker group 9.2; (Rademaker et al., 2005, Barak et al., 2016). The fourth lineage includes strains denoted as X. axonopodis, such as pv. manihotis (Rademaker group 9.4; (Rademaker et al., 2005, Mhedbi-Hajri et al., 2013). The fifth lineage includes X. translucens (Langlois et al., 2017), within the distinct cluster of "early-branching" species whose divergence from the remainder apparently occurred relatively early during Xanthomonas speciation (Parkinson et al., 2007). The sixth lineage comprises X. maliensis, associated with but nonpathogenic on rice (Triplett et al., 2015). Phylogenetic analyses place this species between the "early-branching" species and the remainder (Triplett et al., 2015).
Notably, the raxX-raxSTAB gene cluster is absent from the group of strains classified as X. citri pathovars (Rademaker group 9.5; (Rademaker et al., 2005, Bansal et al., 2017). These strains (some of which are denoted as X. axonopodis or X. campestris) cluster phylogenetically among four of the raxX-raxSTAB gene cluster-positive groups: X. oryzae, X. vasicola, X. euvesicatoria and X. axonopodis pv. manihotis (Midha & Patil, 2014, Vauterin et al., 1995, Rademaker et al., 2005). The simplest explanation for this pattern is that the raxX-raxSTAB gene cluster was lost from an ancestor of the X. citri lineage (Fig. 3); other explanations are not excluded.
Sequence conservation of the raxX-raxSTAB gene cluster suggests lateral transfer between Xanthomonas spp
Both the organization and size of the raxX-raxSTAB gene cluster are conserved across all six lineages. To assess inheritance patterns, we constructed a phylogenetic tree for the raxX-raxSTAB gene cluster (as the catenation of the four rax genes; Fig. 4) (Kuo & Ochman, 2009). The rax genes in X. translucens, in the early-branching group, cluster separately from their homologs in the other lineages. This finding is consistent with the hypothesis that X. translucens acquired the raxX-raxSTAB gene cluster relatively early during Xanthomonas speciation. For X. maliensis, the raxX-raxSTAB genes are most similar to those from X. euvesicatoria and the X. axonopodis pathovars manihotis and phaseoli (Fig. 4), even though the X. maliensis genome sequence itself is more distantly related (Fig. 3). This finding suggests that X. maliensis acquired the raxX-raxSTAB gene cluster relatively late during Xanthomonas speciation.
Boundaries flanking the raxX-raxSTAB gene cluster and adjacent genes suggest lateral transfer through general recombination
The raxX-raxSTAB gene cluster lies between two core (housekeeping) genes (Fig. 1). One, gcvP, encodes the pyridoxal-phosphate subunit of glycine dehydrogenase. An approximately 170 nt riboswitch (gcvR in Fig. 1) controls GcvP protein synthesis in response to glycine (Mandal et al., 2004). The other, "mfsX", encodes a major facilitator subfamily (MFS) transporter related to Bcr and CflA efflux proteins (da Silva et al., 2004). Here, "mfsX" is only a provisional designation absent functional characterization.
Comparing the gcvP - [raxX-raxSTAB]- "mfsX" region from the reference genomes reveals sharp boundaries flanking the position of the raxX-raxSTAB gene cluster. On the left flank, substantial nucleotide identity spans the gcvP gene, the gcvR riboswitch, and a predicted gcvR promoter –10 element (Mitchell et al., 2003) (Fig. S2). On the right flank, identity begins shortly after the "mfsX" initiation codon. Accordingly, upstream sequence elements for initiating "mfsX" gene transcription (Mitchell et al., 2003) and translation (Ma et al., 2002) are conserved within, but not between, raxX-raxSTAB gene cluster-positive and -negative sequences (Fig. S2).
Between these boundaries in raxX-raxSTAB gene cluster-negative species, the compact (≤ 200 nt) gcvP-"mfsX" intergenic sequence is modestly conserved in most genomes (about 60-80% overall identity; Fig. S2). Much of this identity comes from the "mfsX" potential transcription and translation initiation sequences described above. The overall intergenic sequence is less conserved in the early-branching species (X. albilineans, X. hyacinthi and X. sacchari), displaying about 50-65% overall identity.
We hypothesize that raxX-raxSTAB gene cluster phylogenetic distribution results from general recombination between conserved genes flanking each side (e.g., in or beyond the gcvP and "mfsX" genes). Two observations are consistent with the hypothesis, First, we observed that the sequences flanking the raxX-raxSTAB gene cluster are different from the gcvP-"mfsX" intergenic sequence in raxX-raxSTAB gene cluster-negative strains (Fig. S2). This argues against models in which the raxX-raxSTAB gene cluster has integrated into the gcvP-"mfsX" intergenic sequence during lateral transfer events.
The second observation consistent with lateral transfer via general recombination is that gcvP length polymorphisms (Fig 1 and Fig. S3) do not align with Xanthomonas phylogenetic relationships (Fig. 3). Inheritance patterns such as this often result from general recombination in the vicinity (Nelson et al., 1997).
Notably, this gcvP-"mfsX" intergenic region conserved is also conserved in the X. citri lineage (Fig. S2). If the raxX-raxSTAB gene cluster was lost during formation of this lineage (see above), then general recombination would replace the resident raxX-raxSTAB gene cluster with a donor conserved gcvP-"mfsX" region.
raxST but not raxX homologs are present in genomes from diverse bacterial species
Our GenBank database searches identified raxX homologs and the raxX-raxSTAB gene cluster only in Xanthomonas spp. However, these searches did identify raxST homologs encoding proteins with about 40% identity to, and approximately the same length as, the Xoo RaxST protein. These sequences include the PAPS-binding motifs that define sulfotransferase activity (da Silva et al., 2004, Negishi et al., 2001). Regardless of its current function, a raxST homolog potentially could evolve to encode tyrosylprotein sulfotransferase activity.
None of these raxST homologs is associated with a raxX homolog, and most also are not associated with raxA or raxB homologs. Presumably, the enzymes by these raxST homologs act on substrates other than RaxX. These raxST homologs support the hypothesis that the raxSTAB cluster arose from a new combination of pre-existing raxST, raxA, and raxB homologs. Proteolytic maturation and ATP-dependent peptide secretion systems are broadly distributed and so raxA and raxB homologs are plentiful in bacterial genomes (Holland et al., 2016).
These raxST homologs are in diverse genetic contexts in a range of bacterial phyla including Proteobacteria and Cyanobacteria (Fig. S4). Nevertheless, for most species represented by multiple genome sequences, the raxST homolog was detected in a minority of individuals, so it is not part of the core genome in these strains. Moreover, relationships between species in a raxST gene phylogenetic tree bear no resemblance to those in the overall tree of bacterial species. For example, in the raxST gene tree, sequences from Cyanobacteria are flanked on both sides by sequences from Proteobacteria (Fig. S4). Together, these findings provide evidence for lateral transfer of raxST homologs (Kuo & Ochman, 2009).
RaxX protein sequence variants representing all six raxX-raxSTAB gene cluster-positive lineages
RaxX protein sequences from diverse Xanthomonas spp. assort into several sequence groups differentiated by polymorphisms within the predicted mature peptide sequence (Fig. 2) (Pruitt et al., 2017). Many of these groups are subdivided further according to polymorphisms in the predicted leader protein sequence (residues 1-39) or carboxyl-terminal region distal to residue Pro-52. Most leader polymorphisms lie between residues 2-24, and are unlikely to affect function of mature RaxX protein. Here we only consider polymorphisms in the predicted mature form.
To assess the function of RaxX variants, we focused on frequently observed variants in species represented by numerous genome sequences (Fig. S1). These include sequence groups A, B and D from X. oryzae pv. oryzae and X. oryzae pv. oryzicola, as well as sequence groups E, G and H, representing most genomes for the X. euvesicatoria and X. vasicola groups (Fig. 2). Finally, sequence group K is most numerous among X. translucens genomes. The comparison reference is the RaxX protein sequence from the Philippines Xoo strain PXO99A (sequence group A). Examples from lower frequency (mostly unique) sequence groups were analyzed by complementation, as described below.
RaxX variants promote root growth but fail to activate the XA21-mediated immune response
We generated and purified tyrosine-sulfated full-length (unprocessed) RaxX peptides for these seven variants using an expanded genetic code approach (see methods) (Fig. 2), together representing all five pathogenic lineages that contain the raxX-raxSTAB gene cluster. The positive control is RaxX21-sY, a synthetic 21 residue tyrosine-sulfated peptide with strong activity (Pruitt et al., 2015). These peptides were used in two separate assays for function. First, we performed root growth experiments with an Arabidopsis thaliana tpst-1 mutant lacking tyrosylprotein sulfotransferase, which is required for all known sulfated tyrosine peptide hormones including PSY (Matsubayashi, 2014). This eliminates endogenous PSY activity so that effects of added peptides are more easily observed (Pruitt et al., 2017, Matsubayashi, 2014). Root lengths for seedlings grown without added peptide averaged 23.5 mm, whereas root lengths for seedlings grown with 100 nM peptide were at least twice as long (Fig. 5A and Fig. 5B). This observation is consistent with the hypothesis that these peptides mimic PSY1 peptide hormone activity. Note that three of these variants (groups D, E and G) were examined previously (Pruitt et al., 2017) and are included here to facilitate direct comparisons as well as to monitor consistency of results.
In the second assay, we tested each RaxX peptide for direct activation of XA21-mediated immunity by assaying induction of the PR10b marker gene as a readout for immune activation (Thomas et al., 2016, Pruitt et al., 2015). In contrast to results with the root growth assay, here only the group A RaxX protein (from Xoo strain PXO99A) was able to induce XA21-mediated PR10b marker gene expression (Fig. 5C).
In a separate test for activation of XA21-mediated immunity, we used a □raxX deletion mutant of Xoo strain PXO99A as a host for genetic complementation. We tested each of the raxX alleles shown in Fig. 2, which includes examples from lower frequency (mostly unique) sequence groups. We introduced each raxX allele into the □raxX test strain, and monitored disease progression in leaves of whole plants. Only the group A raxX allele (from Xoo strain PXO99A) was able to complement the Xoo PXO99A □raxX strain to activate XA21-mediated immunity (Fig. 6). Expression of each raxX allele was confirmed by qPCR (Fig. S5).
Together, these results provide direct evidence that activation of XA21-mediated immunity is restricted to RaxX proteins from sequence group A, found in most strains of Xoo. None of the other X. oryzae RaxX variants tested (including RaxX from X. oryzae pv. oryzicola) was able to activate XA21-mediated immunity. The observation that all RaxX proteins tested stimulated Arabidopsis root growth suggests that the RaxX PSY peptide mimicry function is not restricted to rice.
African Xoo strain AXO1947 RaxX and RaxST natural variants both lead to evasion of the XA21 immune receptor
The raxX alleles from Xoo strains IXO685 and AXO1947 failed to complement the □raxX mutant of Xoo strain PXO99A for XA21 immune activation (Fig. 6). In addition to its variant raxX allele (Fig. 2), we noted that Xoo strain AXO1947 (Huguet-Tapia et al., 2016) carries seven missense polymorphisms in the raxST gene (Fig. S6) not present in other Xoo strains such as IXO685. To determine if the variant raxST allele from strain AXO1947 encodes a functional protein, we performed additional complementation tests.
We found that the raxX allele from strain PXO99A conferred the XA21 immune activation phenotype upon strain IXO685 but not upon strain AXO1947 (Fig. 7B). This result suggests that the raxX variant allele is not the only factor that prevents strain AXO1947 from activating the XA21 immune response. Consistent with this hypothesis, the raxST allele from strain PXO99A failed to confer the XA21 immune activation phenotype upon strain AXO1947 (Fig. 7D). In contrast, addition of both the raxX and raxST alleles from strain PXO99A was sufficient to confer the XA21 immune activation phenotype upon strain AXO1947 (Fig. 7F).
Taken together, these results suggest that Xoo strain AXO1947 has mutant versions of both genes, raxST and raxX. Analysis by qRT-PCR confirms that these genes were expressed in the complemented strains (Fig. S7).
RaxST variants from Xoo strain AXO1947
To determine which of the RaxST missense polymorphisms is responsible for the apparent reduction in enzyme activity, we used site-specific mutagenesis to introduce each individually into the raxST gene from strain PXO99A. Genes encoding two of these [His-50 to Asp (H50D) and Arg-129 to Leu (R129L)] were unable to complement the □raxST mutant of Xoo strain PXO99A for XA21 immune activation (Fig. 8), indicating that both His-50 and Arg-129 are necessary for RaxST activity.
Little is known about RaxST structure and function. Diverse sulfotransferases share limited sequence similarity, mostly comprising two relatively short sequence motifs involved in PAPS binding (Negishi et al., 2001). These motifs are conserved in the Xoo RaxST sequence (da Silva et al., 2004). Research with diverse sulfotransferases has identified three essential residues: a positively-charged residue (corresponding to Arg-11 in RaxST) in one PAPS binding motif, an invariant Ser (corresponding to Ser-118 in RaxST) in the other, and a catalytic base (His or Glu) located between the two PAPS binding motifs (Negishi et al., 2001).
We generated a RaxST molecular model with the program iTasser (Yang & Zhang, 2015) using the crystal structure of human tyrosylprotein sulfotransferase-2 (TPST2) as a template (PDB: 3AP1). The sequence alignment is shown in Fig. S8. TPST2 is a functional dimer (Teramoto et al., 2013), which is replicated in the RaxST structural model (Fig. S9). The two essential residues identified from Xoo strain AXO1947, His-50 and Arg-129, display surface exposed side chains in close proximity to the corresponding position for the bound substrate peptide co-crystalized with TPST2. These residues are distal to the catalytic site. Therefore, we hypothesize that these RaxST residues are involved in RaxX peptide binding.
DISCUSSION
We previously hypothesized that RaxX mimics the actions of PSY hormones, and that the XA21 receptor evolved specifically to recognize RaxX from Xoo (Pruitt et al., 2015, Pruitt et al., 2017). This prediction is supported here by our finding that all the RaxX variants tested stimulate root growth (Fig. 5A and Fig. 5B) (Pruitt et al., 2017) but fail to activate the XA21-mediated immune response (Fig. 5C and Fig. 6). Thus, RaxX sequence determinants are more stringent for XA21-mediated immunity activation than for root growth stimulation. In this discussion, we consider two questions: (1) What are potential selective pressures acting on RaxX that affect sequence variation; and (2) How was the raxX-raxSTAB gene cluster inherited in Xanthomonas spp.?
Opposing selection pressures drive RaxX natural variation
Maintenance of the raxX-raxSTAB gene cluster (Fig. 3) suggests that RaxX provides fitness benefits to diverse Xanthomonas spp., presumably during their interactions with hosts that collectively encompass a range of monocot and dicot species. This hypothesis is supported by in vivo data showing that Xoo strains lacking the raxX or raxST genes are compromised for virulence (Pruitt et al., 2015, Pruitt et al., 2017). On the other hand, rice-restricted XA21-mediated immunity would select specifically against RaxX maintenance by Xoo. Analysis of raxX-raxSTAB gene cluster sequence polymorphisms suggests that both types of selection occur.
The Xa21 gene has been introgressed into commercial rice varieties (Khush et al., 1990, Midha et al., 2017). Widespread planting of Xa21 rice presumably increases selection for Xoo variants that evade XA21-mediated immunity. All RaxX missense variants examined mimicked PSY hormone activity (Fig. 5A and Fig. 5B) (Pruitt et al., 2017), suggesting that this property confers a selective advantage. Consistent with this, we did not observe any raxX frameshift or nonsense alterations. Instead, RaxX variant sequences contain a restricted set of missense substitutions, consistent with the hypothesis that selection acts to retain PSY-like function (Fig. 2; see reference (Pruitt et al., 2017)).
Among all RaxX variants tested, only that from Xoo strain PXO99A (which represents the large majority of Xoo raxX alleles) activated the XA21-mediated immune response (Fig. 5C and Fig. 6). This result demonstrates that recognition of RaxX by XA21 is strictly limited to Xoo, and confirms and extends a prior conclusion from our laboratory, that residues Pro-44 and Pro-48 both are required for Xoo RaxX recognition by XA21 (Pruitt et al., 2015).
Thus, it appears that some Xoo strains that evade activation of XA21-mediated immunity arise from a restricted set of raxX missense substitution alleles encoding variants that retain PSY-like function. This observation suggests that it may be possible to engineer novel XA21 variants that recognize these variant RaxX proteins. If so, it may then be possible to engineer broad-spectrum resistance against Xoo (and other raxX-raxSTAB gene cluster-positive Xanthomonas spp.) by expressing multiple XA21 proteins that collectively recognize multiple RaxX variants.
We also have identified raxST and/or raxA gene loss of function alterations in Xoo field isolates (Fig. 7; reference (da Silva et al., 2004), which presumably cannot express the PSY mimicry phenotype of RaxX). Such loss of function alterations could temper the effectiveness of production strategies that rely on engineered Xa21 alleles.
raxX-raxSTAB gene cluster origin
The raxAB genes are homologous to those encoding proteolytic maturation and ATP-dependent peptide secretion complexes (da Silva et al., 2004, Lin et al., 2015), related to type 1 secretion systems but specialized for secreting small peptides such as bacteriocins and peptide pheromones (Holland et al., 2016). Frequently, the gene encoding the secreted substrate is adjacent to genes encoding components of the secretion complex (Dirix et al., 2004). We hypothesize that the intact raxX-raxSTAB gene cluster originated in an ancestor to the lineage containing X. oryzae, X. euvesicatoria, and related species, with subsequent gains or loss through lateral transfer (Fig. 2). Relatively few events appear to have been necessary to form the raxX-raxSTAB gene cluster. The raxX gene might have evolved from the gene for the secreted peptide substrate of the RaxAB ancestor. The complete cluster would result from incorporation of the ancestral raxST gene, homologs of which are distributed broadly (Fig. S4).
Role for the raxX-raxSTAB gene cluster in Xanthomonas biology
The raxX-raxSTAB gene cluster does not exhibit features, such as a gene for a site-specific recombinase, characteristic of self-mobile genomic islands (Hacker et al., 1997). Instead, evidence suggests that raxX-STAB gene cluster lateral transfer occurred through general recombination between genes flanking each side of the raxX-STAB gene cluster (Fig. 1 and Fig. S2). In bacteria, gene acquisition through lateral transfer contributes to emergence of new pathovars (see reference (Ogura et al., 2009) for one example). Conceivably, lateral acquisition of the raxX-raxSTAB gene cluster might allow a particular strain to infect a previously inaccessible host.
Xanthomonas pathovar phenotypes (Jacques et al., 2016) are not predicted by the presence or absence of the raxX-raxSTAB gene cluster. For example, some raxX-raxSTAB gene cluster-positive species can infect only monocots (e.g., X. oryzae, X. translucens) or only dicots (e.g., X. euvesicatoria), just as some raxX-raxSTAB gene cluster-negative species also can infect only monocots (e.g., X. arboricola, X. hyacinthi) or only dicots (e.g., X. campestris pv. campestris; X. citri). Similarly, some raxX-raxSTAB gene cluster-positive species are specific for vascular tissue (e.g., Xoo; X. vasicola) or for non-vascular tissue (e.g., X. oryzae pv. oryzicola; X. euvesicatoria), just as some raxX-raxSTAB gene cluster-negative species also are specific for vascular tissue (e.g., X. hortorum; X. albilineans) or for non-vascular tissue (e.g., X.citri; X. arboricola). Thus, selective function(s) for the raxX-raxSTAB gene cluster in Xanthomonas spp. remain to be determined.
Experimental Procedures
Survey of the RaxX, RaxST and the raxX-STAB genomic region in publicly available databases
We used the 5kb long Xoo PXO99A raxX-raxSTAB genomic region, including 600 bp upstream of raxST and 70 bp downstream of raxB, as query to search the following NCBI databases with blastn and megablast using e-value cut-off of 1e-3; nr/nt, htgs, refseq_genomic_representative_genomes, refseq_genomic, and gss. To identify RaxX homologs we used the protein sequence of RaxX from Xoo PXO99A as query to search the same databases using tblastn with a PAM30 scoring matrix to account for the short sequence length of RaxX. In case of raxST from Xoo PXO99A we used the genomic coding sequence to search the same databases using the same cut-offs. In addition, we used the RaxST protein sequence to search the following database using blastp with an e-value cut-off of 1e-3 and a BLOSUM62 scoring matrix; nr, refseq_protein, env_nr. The databases were last accessed 2016/01/06 for the initial manuscript submission and 2018/06/25 during preparation of the resubmission. Searches were restricted to bacteria (taxid: 2) in case of refseq_genomic_representative_genomes. The observations of specificity of raxX and the intact raxX-raxSTAB gene cluster to the genus Xanthomonas was consistent across all queries.
Whole genome based phylogenetic tree for Xanthomonas spp
All available Xanthomonas genomes were downloaded from the NCBI ftp server on January 29, 2016 (413 genome accessions). The genome fasta files were used to build a local blast database using BLASTv2.27+ (Camacho et al., 2009). For all genes in and surrounding the raxSTAB cluster blastn (evalue cutoff of 1e-3) was used to identify homologs in the local blast database. Due to the small size of RaxX, tblastn was required to identify homologs (evalue cutoff of 1e-3). Fasta files for each blast hit were generated using a custom python script (available upon request). Alignments of all genes were performed with Muscle v3.5 (Edgar, 2004) implemented in the desktop tool Geneious v9.1.8 (Kearse et al., 2012). Alignment ends were trimmed so that each sequence was equal in length and in the first coding frame. Maximum likelihood trees were built with RaxML v8.2.4 (Stamatakis, 2014) with the following settings: (-m GTRGAMMA F -f a -x 3298589 -N 10000 -p 23). Trees shown in all figures are the highest scoring ML tree and numbers shown on branches are the resampled bootstrap values from 1000 replicates. Trees were drawn in FigTree v1.4.0 (http://tree.bio.ed.ac.uk/software/figtree/).
Whole genome phylogenies were generated using the entire genome assembly with the program Andi v0.10 (Haubold et al., 2015, Klotzl & Haubold, 2016). These distance matrices were plotted as neighbor-joining tree using Phylip v3.695 (Felsenstein, 1981). Numbers on the branches represent the proportion (0-100) that the branch appeared in the “bootstrapped” distance matrices using Andi.
Sequence analyses
Nucleotide and deduced amino acid sequences were edited and analyzed with the programs EditSeqTM (version 14.1.0), MegAlignTM (version 14.1.0) and SeqBuilderTM (version 14.1.0), DNASTAR, Madison, WI. The Integrated Microbial Genomes interface (Chen et al., 2017) was used to compare genome segments from different species.
Bacterial growth
Xanthomonas strains were cultured at 28°C. Solid medium was peptone sucrose agar (PSA; pH 7.0), which contains (per liter) peptone (10 g), sucrose (10 g), sodium glutamate (1 g) and agar (15 g). Liquid cultures were aerated at 230 rpm in YEB medium (pH 7.3), which contains (per liter) yeast extract (5 g), tryptone (10 g), NaCl (5 g), sucrose (5 g), and MgSO4 (0.5 g). Antibiotics were kanamycin, carbenicillin, spectinomycin (all at 50 □g/ml), and cephalexin (20 □g/ml).
Rice growth and inoculation
Oryza sativa ssp. japonica rice varieties were TP309 and XA21-TP309, which is a 106-17-derived transgenic line of TP309 carrying the Xa21 gene expressed from its native promoter (Song et al., 1995). TP309 rice does not contain the Xa21 gene. Seeds were germinated in distilled water at 28°C for one week and then transplanted into sandy soil (80% sand, 20% peat; Redi-Gro) in 5.5-inch square pots with two seedlings per pot. Plants were grown in tubs in a greenhouse, and were top watered daily with fertilizer water [N, 58 ppm (parts per million); P, 15 ppm; K, 55 ppm; Ca, 20 ppm; Mg, 13 ppm; S, 49 ppm; Fe, 1 ppm; Cu, 0.06 ppm; Mn, 0.4 ppm; Mo, 0.02 ppm; Zn, 0.1 ppm; B, 0.4 ppm] for four weeks, followed by water for two weeks. Six weeks after planting, rice pots were transferred to a growth chamber with the following day/night settings: 28°C/24°C, 80%/85% humidity, and 14/10-hour lighting. Plants were inoculated 2 to 3 days after transfer using the scissors clipping method (Song et al., 1995). Bacteria for inoculation were taken from PSA plates and resuspended in water at a density of approximately 8 × 108 CFU/ml. Water-soaked lesions were measured 14 days after inoculation.
Complementation tests
The Xoo strain PXO99A marker-free deletions □raxX and □raxST were described previously (Pruitt et al., 2015). The raxX and raxST genes from different Xanthomonas spp. were cloned into plasmid vector pVS61 and electrotransformed into the appropriate recipient strains as described previously (Pruitt et al., 2015). Site-specific mutational alterations were introduced by PCR using the In-Fusion HD cloning system (Takara).
RaxX peptide stimulation of PR10b gene expression
Full-length sulfated RaxX proteins were purified from an E. coli strain with an expanded genetic code that directs incorporation of sulfotyrosine at the appropriate position (Schwessinger et al., 2016). The resulting MBP-3C–RaxX-His fusion proteins were incubated with 3C protease followed by anion exchange chromatography in order to remove the amino-terminal maltose binding protein tag, as described previously (Schwessinger et al., 2016). The control peptide, sulfated RaxX21-sY, has been described (Pruitt et al., 2015).
Rice plants were grown in a hydroponic system in growth chambers at 24° or 28°C with a 14-hour/10-hour light-dark cycle at 80% humidity. Seedlings were grown in A-OK Starter Plugs (Grodan) and watered with Hoagland’s solution twice a week. Peptide influence on PR10b marker gene expression was measured as described previously (Pruitt et al., 2015). Briefly, leaves of 4-week-old hydroponically grown rice plants were cut into 2-cm-long strips and incubated for at least 12 hours in ddH2O to reduce residual wound signals. Leaf strips were treated with the indicated peptides and then snap-frozen in liquid nitrogen before processing. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was done as described previously (Pruitt et al., 2015). Gene expression was normalized to the actin gene expression level and to the respective mock-treated control at 0 or 9 hour.
DNA primers for qRT-PCR were: ampC-F, GACTCGTAATGCCTACGACC; ampC-R, AATTGCTCGTAGAAGCTGCC; qraxST-F, CTTCCAACGTGCAGATCGAC; qraxST-R, TATCGACGATCCAACCAAC; qRaxX-F, AAAATCGCCCGCCAAGGGT; qRaxX-R, TCAATGGTGCCCGGGGTTG; PR10b-F, TGTGGAAGGTCTGCTTGGAC; PR10b-R, CCTTTAGCACGTGAGTTGCG
Acknowledgements
Supported by NIH GM59962 and GM122968 to Pamela C. Ronald. We are grateful to anonymous reviewer 2 for homology modeling. We thank Simon Williams from Research School of Biology at Australia National University, Canberra and Michael Steinwand from the Ronald laboratory for their assistance with RaxST homology modeling.
Footnotes
↵† Co-first author, in alphabetical order