Abstract
Wolbachia-mediatedprotection against viral infection has been extensively demonstrated in Drosophila and in mosquitoes that are artificially inoculatedwith D. melanogaster Wolbachia (wMel), but to date no evidence for Wolbachia-mediated antibacterial protection has been demonstrated in Drosophila.Here we show that D. melanogaster carrying wMel shows reduced mortality during enteric – but not systemic - infection with the opportunist pathogen Pseudomonas aeruginosa, and that protection is more pronounced in male flies. Wolbachia-mediated protection is associated with increased early expression of the antimicrobial peptide attacinA, followed by increased expression of a ROS detoxification gene (gstD8), and other tissue damage repair genes which together contribute to greater host resistance and disease tolerance. These results highlight that the route of infection is important for symbiont-mediated protection from infection, that Wolbachia can protect hosts by eliciting a combination of resistance and disease tolerance mechanisms, and that these effects are sexually dimorphic.
Introduction
All organisms experience a combination of beneficial and detrimental colonisations by pathogens, commensals and symbionts, with profound effects on host physiology, behaviour, ecology and evolution (Bennett and Moran, 2015; Douglas, 2015; Gandon and Vale, 2014; Lewis and Lizé, 2015; Werren et al., 2008). Bacterial endosymbionts of insects, for example, are known to manipulate host reproduction (Engelstädter and Hurst, 2009; Werren et al., 2008), to alter the host's acquisition of essential nutrients(Douglas, 2015, 1998), and to provide protection from the deleterious effects of parasites and pathogens (Brownlie and Johnson, 2009; Hamilton and Perlman,2013).
Wolbachia is a maternally-inherited, intracellular bacterium of arthropods and nematodes, and is one of the best studied microbial symbionts (Brownlie and Johnson, 2009; Hamilton and Perlman, 2013). Its host range is vast, with recent estimates that 48-57% of all terrestrial arthropods (Weinert et al., 2015), and at least 10% of all Drosophila species carry Wolbachia (Mateos et al., 2006). The ability of some Wolbachia strains to protect insect hosts from pathogenic infections make it particularly relevant for potential bio-control of insect vectored zoonotic infections, and more broadly, relevant as mediators of pathogen-mediated selection in insects (Brownlie and Johnson, 2009; Hamilton and Perlman, 2013; Karyn N. Johnson, 2015). Aedes aegypti and Ae. albopictus mosquitoes, for example, have been shown to become more resistant to Dengue and Chikungunya viruses, as well as malaria-causing Plasmodium when they are experimentally inoculated with Wolbachia (Bian et al., 2010; Kambris et al., 2010; Moreira et al., 2009). In Drosophila, there is also ample evidence that flies carrying Wolbachia are better able to survive infection by a number of naturally occurring RNA viruses (Hedges et al., 2008; Hedges and Johnson, 2008; Karyn N Johnson, 2015; Teixeira et al., 2008). This anti-viral protection is variable among strains of Wolbachia and correlates strongly with the reduction in viral titres within hosts (Martinez et al.,2014), suggesting that Wolbachia generally enhances the ability to clear pathogens (increasing host resistance) rather than the ability to repair damage independently of pathogen clearance (disease tolerance) (Ayres and Schneider, 2012; Råberg et al., 2009).
In contrast to the strong evidence for Wolbachia-mediated antiviral protection, its ability to protect its native fruit fly hosts from bacterial infections has not been clearly demonstrated to date. In one study, carrying Wolbachia did not affect the survival or immune activity of D. simulans or D. melanogaster during systemic infection with Pseudomonas aeruginosa, Serratia marcescens or Erwinia carotovora (Wong et al., 2011), while another study found that the presence of Wolbachia had no effect on the ability to suppress pathogen growth during systemic infections by intracellular (Listeria monocytogenes, Salmonella typhimurium) or extracellular bacterial pathogens (Providencia rettgeri) (Rottschaefer and Lazzaro, 2012). Given that Wolbachia can provide broad-spectrum protection against a range of pathogens, including bacteria, in mosquitoes (Ye et al., 2013), the lack of evidence for antibacterial protection in flies is puzzling. Some authors have proposed that antibacterial protection may only occur in novel host-Wolbachia associations (like those of mosquitoes), although the exact mechanism for such protection remains unclear (Wong et al., 2011; Zug and Hammerstein, 2015).
One possibility is that the experimental conditions under which Drosophila are commonly challenged with pathogens in the lab do not reflect the infections they are likely to encounter in the wild. For example, experimental infections often focus on systemic infection, introducing large quantities of bacterial pathogens via intra-thoracic or abdominal injection (Neyen et al., 2014; Rottschaefer and Lazzaro, 2012; Wong et al.,2011). The ecological context of fruit flies however, which consists mainly of foraging on rotting organic matter, means that most pathogens in the wild are more likely to be acquired orally, resulting in enteric, rather than systemic infections (Ferreira et al., 2014; Stevanovic and Johnson, 2015). It is therefore conceivable that any form of Wolbachia-mediated protection that could have evolved in the context of enteric infection may not be detected during systemic infection.
Here we show that the route of infection is indeed important for Wolbachia-mediated protection in Drosophila, which we find to occur during enteric - but not systemic - infection by the opportunist pathogen Pseudomonas aeruginosa. P. aeruginosa has an incredibly broad host range, infecting insects, nematodes, plants, and vertebrates, and is found in most environments (Apidianakis and Rahme, 2009; Neyen et al., 2014). Enteric infection of Drosophila by P. aeruginosa results in pathology to intestinal epithelia due the formation of a bacterial biofilm in the crop, a food storage organ in the foregut (Mulcahy et al., 2011; Sibley et al., 2008). In the majority of enteric infections P. aeruginosa growth is restricted to the crop, and is sufficient to cause death (Chugani et al., 2001; Sibley et al., 2008). We exposed flies that were naturally infected with Wolbachia, and identical derived flies that were cured of Wolbachia infection, to P. aeruginosa either through intra-thoracic pricking (causing a systemic infection) or through the oral route of infection by feeding (causing an enteric infection). We then monitored how within-host microbe loads and survival varied throughout the course of an infection to assess if (1) Wolbachia-mediated protection occurred during systemic and enteric bacterial infection; (2) when protection was detected, if this was due to differences in the bacterial clearance rate (resistance) or if it aided host survival despite high microbe loads (tolerance); and (3) how these protective effects differed between male and female flies. We further characterized the expression of immune and damage repair genes previously shown to be involved in enteric bacterial infection in Drosophila.
Results
Wolbachia reduces mortality during enteric but not systemic bacterial infection
All flies infected systemically with PA14 via intra-thoracic pricking died within 24 hours (Fig 1a), and in line with previous work (Wong et al., 2011), we did not detect any significant effect of Wolbachia status on the rate at which they died (Cox Proportional Hazard Model, Likelihood Ratio X2 = 0.003, DF=1, p=0.959), regardless of sex ( ‘Sex’ effect, X2= 0.860, DF=1, p=0.354). Flies that ingested and acquired an enteric infection of PA14 died at a faster rate than control flies exposed only to a sucrose solution (Fig. 1b; ‘Infection status’ effect, Likelihood Ratio X2= 64.27, DF=1, p<0.0001). Fly mortality during enteric infection was significantly affected by their Wolbachia status (X2= 6.32, DF=1, p=0.013). This protective effect was not substantial in female flies: female flies without Wolbachia were 1.58 more likely to die than infected females carrying Wolbachia (Cox risk ratio, X2 = 1.27, p=0.2644). The protection in male flies was more pronounced, where not carrying Wolbachia made PA14-infected males 2.26 times more likely to die than their infected Wolbachia-positive counterparts (Cox risk ratio, X2 = 4.22, p=0.0172)(Figure 1b). In order to understand the cause of the observed protection during enteric but not systemic infection protection, the results below focus only on flies that acquired infection orally.
Wolbachia does not affect the rate of bacterial clearance during enteric infection
Following 12 hours of exposure to P. aeruginosa, bacterial loads decreased over the course of the experiment in both male and female flies (Fig. 2) time effect F7,186=48.81, p<0.0001). However, the rate at which infection was cleared was not affected by Wolbachia status (‘Time × Wolbachia’ interaction F7,186=5.71, p=0.30), which suggests that the presence of Wolbachia does not contribute to the clearance of this bacterial gut infection. Regardless of Wolbachia status, we observed that males and females showed different patterns of bacterial clearance over time (Fig. 2; ‘Time × Sex’ interaction F7,186=4.21, p=0.002). While males appeared to be able to clear the infection almost entirely within a week (mean ± SEM 0.85 ±0.29 Log10 CFU per fly at 168 hours post exposure) females appeared to stop clearing infection after 96h, maintaining a relatively stable bacterial load of about 100 CFUs per fly until the end of the experiment (Fig. 2). These sex differences in bacterial clearance were present regardless of the Wolbachia status of the flies, suggesting they reflect sexual dimorphism in antibacterial defence and not to sex-specific effects of Wolbachia (Sex × Wolbachia interaction Fi,i86=0.10, p=0.758).
Male flies with Wolbachia have lower bacterial loads in the early stages of enteric infection
The initial stages of exposure to pathogens can be crucial in determining whether the host controls infection or if a pathogen grows to a point where hosts are killed. Even though we detected no difference in the rate of clearance according to Wolbachia status throughout the infection, at 12 and 24-hours post-infection male flies harbouring Wolbachia showed significantly lower bacterial CFUs compared to those without Wolbachia (Fig 2; Wol+: 3.86±0.22 Log10 CFU; Wol-: 4.56±0.22 Log10CFU; F1,20 = 5.27, p= 0.033). One explanation for the difference in initial microbe loads in males is that Wolbachia could cause behavioural changes, such as reduced feeding rate, that result in reduced infection. However, we did not find evidence that the lower CFU numbers seen in Wolbachia-positive male flies resulted from lower feeding rates (Fig. S1). Another potential explanation for the difference in initial microbe loads in males is a Wolbachia-mediated antimicrobial response. Whole fly homogenate added to growing cultures of PA14 (in both liquid and solid growth medium) showed greater antimicrobial activity in homogenates of Wolbachia positive flies (Figure S2 and S3).
Wolbachia-positive flies show increased expression of IMD pathway genes during the early stages of enteric infection
Given the preliminary evidence of increased antimicrobial activity in Wolbachia-positive males (Figure S2 and S3), we decided to test for differences in the expression of antimicrobial immune pathways. While previous work has found no effect of Wolbachia on the expression of immune genes (Wong et al., 2011), or on bacterial clearance(Rottschaefer and Lazzaro, 2012), this has not been tested in the context of enteric bacterial infection. Other studies in Wolbachia-free flies have demonstrated that the IMD pathway plays an active role in the response to enteric bacterial infection (Buchon et al., 2014, 2009; Kuraishi et al., 2011). We therefore tested whether flies carrying Wolbachia showed increased expression of genes involved in IMD-mediated antimicrobial immunity.
In Wolbachia-positive females, we observed a significant increase in expression (relative to uninfected females) of two IMD pathway receptor genes-pgrp-lc (p = 0.0002) and pgrp-le (p = 0.004) at 96-hours post-infection (Fig. 3). In PA14-infected males, however, carrying Wolbachia resulted in a slight decrease in pgrp-lc expression relative to uninfected males (p = 0.03), although this difference was transient and only observed at 24-hours post-infection (Fig. 3). Overall there appears to be little effect of Wolbachia on the expression of either receptor gene in male flies (Fig 3). We observed a significant 3 to 4-fold increase in the expression of the antimicrobial peptide (AMP) gene attacinA (attA) in Wolbachia-positive males at both 24 hours (p = 0.002) and 96 hours (p < 0.001) post-infection. We did not detect any difference in the expression of this AMP gene in male flies that were free of Wolbachia, or in female flies, regardless of their Wolbachia status (Fig. 3). These results suggest that the initial difference in clearance between Wol+ and Wol-male flies could at least in part be due to Wolbachia-mediated up-regulation of the AMP attacinA.
Wolbachia contributes to increased disease tolerance in male flies
The data we describe above reveals interesting differences in the way male and female flies fight enteric bacterial infection. Male flies are able to clear infection almost completely, while female flies stop clearing infection after 96 hours and maintain a stable bacterial load following that same time period, which suggests that male flies are better than females at clearing enteric PA14 infection (Fig. 2). We could therefore expect females to pay a survival cost due to higher bacterial loads but instead we find that female flies have a similar survival probability to males, especially for flies that are Wolbachia negative (Fig. 1). This suggests that females are better able than males to tolerate P. aeruginosa enteric infection because they are able to maintain a similar level of health to females, while tolerating higher bacterial loads (Ayres and Schneider, 2012; Medzhitov et al., 2012; Râberg et al., 2009). Male flies, however, showed a marked increase in survival when they were Wolbachia positive compared to Wolbachia negative males (Fig. 1), even though the rate at which both groups clear infection appear identical (Fig. 2). This suggests increased tolerance in males mediated by the presence of Wolbachia. In females, the survival benefit of Wolbachia appeared to be minimal, suggesting that Wolbachia-mediated tolerance could be sex-specific.
To better assess these differences in disease tolerance mediated by sex and Wolbachia status, we plotted the relationship between host health and microbe load for matching time-points (Fig. 4). In all cases, these data were better described by a nonlinear 4-parameter logistic model than a linear model (Table S1). The 4-paraemter logistic model is useful to compare how its maximum (reflecting health in the initial stages of infection), baseline (reflecting the lowest survival reached during the experiment), inflection point (the point at which fly survival reached halfway between the baseline and maximum), and the growth rate (reflecting the rate at which fly survival plummets) vary according to host sex and Wolbachia status. Each of these parameters may reflect distinct mechanisms of damage repair involved in host infection tolerance, so they are useful for further exploration of tolerance mechanisms (Ayres and Schneider, 2012; Vale et al., 2016). In female flies, the logistic model explained about a quarter of the variance (R2=0.24), and a formal parallelism test found that the curves did not show significantly different shapes (F3,72=0.886, p=0.452). In male flies, the 4-parameter logistic model explained over half the variance (R2 =0.57), and a formal parallelism test revealed significant differences n the shapes of these two tolerance curves between Wolbachia-positive and Wolbachia-negative males (F3,72 = 2.98, p=0.037). These differences arise not only to the consistently lower maximum and baseline survival in Wolbachia-negative males regardless of microbe load (Figure 4), but also due to differences in the inflection point of each curve which occurs later in the infectious period in Wolbachia-positive male flies (Figure 4).
Wolbachia is associated with higher expression of a ROS detoxification gene in males and epithelial repair genes in females during enteric infection
Damage limitation mechanisms such as those involved in the response to oxidative stress, epithelial renewal and damage repair improve host health during infection while not acting directly to eliminate pathogens. They are therefore putative mechanisms of disease tolerance (Ayres and Schneider, 2012; Vale et al., 2014) and have previously been shown to be up-regulated during enteric bacterial infection (Buchon et al., 2009). Given the differences we observed in the ability to tolerate enteric bacterial infection (Fig. 4) we hypothesized that male and female flies may differ in the expression of such genes according to their Wolbachia status.
In male flies, enteric infection with PA14, led to increased expression of gstD8-involved in ROS detoxification (Buchon et al., 2009; Ha et al., 2005) – which was significantly higher at 96-hours post-infection in those harbouring Wolbachia, while no difference flies was observed in female gstD8 expression according to Wolbachia status.
Since oral infection results in damage to insect guts (Buchon et al., 2014), we also measured the expression of two genes involved in epithelial renewal and damage repair(gadd45 and CG32302) (Buchon et al., 2009). Both genes showed a significant increase in expression in Wolbachia-positive females. Gadd45 expression was marginally higher in Wolbachia-positive females compared to those with out Wolbachia at 24-hours postinfection (p = 0.045), but this differnce increased by 96-hours post-infection (p < 0.001). CG32302 expression was only transiently differentially expressed in Wolbachia-positive females at 24-hours post-infection. Wolbachia-negative males showed a significantly higher expression relative to Wolbachia-positive males of both gadd45 (p = 0.014) and CG32302 (p = 0.004) at 24 hours post-infection, although this difference was no longer observed by 96-hours post-infection.
Discussion
During the last decade, it has become well established that endosymbionts like Wolbachia play a key role in conferring protection from pathogens in their insect hosts (Brownlie and Johnson, 2009; Hamilton and Perlman, 2013; Karyn N. Johnson, 2015). In its natural host Drosophila, Wolbachia-mediated protection is especially evident during viral infections (Chrostek et al., 2013; Hedges et al., 2008; Martinez et al., 2014; Teixeira et al., 2008), but protection from bacterial pathogens in Drosophila had not been demonstrated to date (Rottschaefer and Lazzaro, 2012; Wong et al., 2011). Here we show that the route of infection is important for Wolbachia-mediated protection from bacterial infection. We find that Wolbachia can protect Drosophila from enteric bacterial infection by eliciting a combination of resistance and disease tolerance mechanisms, and that these protective effects are sexually dimorphic.
The route of infection matters
The role of Wolbachia in protecting hosts from infection, either by increasing resistance or tolerance, is known in Drosophila-virus interactions, but previous work testing for antibacterial protection in Drosophila did not find a significant effect of Wolbachia (Rottschaefer and Lazzaro, 2012; Wong et al., 2011). Typically flies in previous studies were inoculated by intra-thoracic pricking or injection, and therefore experienced a systemic infection. In the wild however, infections are more likely to be acquired through the fecal-oral route (during feeding on decomposing fruit), with most pathogens colonising the gut before being shed through the faeces. Drosophila-Wolbachia interactions would therefore have co-evolved mainly under selection by pathogen infection in the gut, and any antibacterial protection that may have evolved as a consequence would not be expected to manifest during a highly virulent systemic infection (Liehl et al., 2006; Martins et al., 2013). Further, if Wolbachia-mediated protection is especially efficient in the fly gut, the damage caused by a generalised systemic infection could overwhelm any localised protection by Wolbachia, which could explain the lack of observed protection in previous studies of systemic bacterial infection in Drosophila. Future studies of host resistance and tolerance should therefore favour natural routes of infection in order to gain a more realistic picture of the mechanisms that hosts have evolved to fight infection.
Wolbachia-mediated protection is a combination of pathogen clearance and damage limitation
The mechanisms underlying Wolbachia-mediated protection are presently unclear, especially given that the extent of the protection, and whether it acts to increase resistance or tolerance appear to be pathogen specific (Chrostek et al., 2013; Martinez et al., 2014; Teixeira et al., 2008). In mosquitos Wolbachia protection appears to be involved in a combination of general immune priming (Rancès et al., 2012), resource competition between Wolbachia and infectious agents (Caragata et al., 2013), and the regulation of host genes involved in blocking pathogen replication (Zhang et al., 2013). In the current experiment it is notable that bacterial numbers did not increase throughout the course of the infection, but were cleared at a near exponential rate (Fig. 2). Despite this, flies still died from infection, although Wolbachia reduced the mortality rate. One possibility is that most of the damage experienced by the host happens at the early stages of infection, and the fact that Wolbachia-positive flies show lower bacterial titres immediately after the exposure period (Fig. 2) may be the reason they also show higher survival later during the infection. This may explain why the male Wolbachia positive flies showed a slower rate of mortality, because attacinA-mediated clearance of PA14 within the first 24 hours post infection (Fig. 3) would have minimized gut damage caused by pathogen growth.
An alternative, although not mutually exclusive, possibility is that most of the damage that causes fly death arises from immunopathology, as an indirect side effect of mechanisms that clear pathogens. For example, a common and broad response to infection in insects is the activation of pathways that result in the production of reactive oxygen species (ROS)(Buchon et al., 2014; Ha et al., 2005; Zug and Hammerstein, 2015). ROS production is tightly regulated (Buchon et al., 2013; Ha et al., 2005), and only activated in response to pathogenic and not commensal bacteria (Lee et al., 2013). Previous work has shown that both mosquitoes (Pan et al., 2012) and flies (Wong et al.,2015) harbouring Wolbachia show higher ROS levels, but also that in some cases ROS production can lead to oxidative stress, DNA damage (Brennan et al., 2012) and damage to the fly gut epithelium (Buchon et al., 2014, 2013). We therefore hypothesised that mechanisms involved in detoxifying ROS during enteric infection with PA14 may underlie the differences in survival between flies with and without Wolbachia (Figure 1). We chose to measure the expression of gstD8, involved in ROS detoxification, because it was previously shown to be up-regulated during enteric infection in Drosophila with another bacterial pathogen, Erwinia carotovora (Buchon et al., 2009).
We found that the expression of gstD8 was elevated in Wolbachia-positive males, but not female flies following 96-hours of oral exposure to P. aeruginosa. This pattern of expression is consistent with the increased survival observed in Wolbachia-positive males compared to males without the endosymbiont (Figure 1b).
In addition to this detoxification response, we also measured the expression of genes involved in tissue damage repair(gadd45) and a component of the peritrophic matrix (CG32302), a protective barrier in the fly gut (Lehane, 1997). In males, the presence of Wolbachia did not result in an increase in these genes within 96 hours of oral exposure to PA14, but females carrying the endosymbiont showed significantly higher expression than Wolbachia-negative flies of gadd45. This shows that Wolbachia induces different damage limitation mechanisms in males (ROS detoxification) and females (tissue damage repair). We also observed transient increases in the expression of CG32302, another component of gut renewal, in Wolbachia-positive females at 24-hours post-infection). There was also a transient increase in expression at 24-hours post-infection of gadd45 and CG32302 in Wolbachia-negative males (Figure 5). We interpret these increases as a response to increased damage to gut tissue cause by the 10-fold higher bacterial loads in these flies after 24 hours (Fig. 2), which was avoided in Wolbachia-positive males by attacinA-mediated clearance.
While previous work found no difference in genome-wide expression levels in adult Drosophila with or without Wolbachia (Teixeira, 2012), and only mild up-regulation of immune genes has been reported in Drosophila cell lines that are transiently infected (Xi et al., 2008), our gene expression results indicate that reducing immunopathology underlies Wolbachia-mediated protection from enteric bacterial infection. We are only beginning to understand the complex sequence of events that occur during gut infection in Drosophila (Lemaitre and Miguel-Aliaga, 2013), which not only consist of antimicrobial defence, but a multifaceted response that includes stress response, DNA damage repair, the renewal of damaged epithelial cells and gut structure, and the maintenance of efficient metabolism (Buchon et al., 2010, 2009; Kuraishi et al., 2011).
Sexual dimorphism in resistance and tolerance
The differences in gene expression we describe above reflect two major forms of defence against infection: mechanisms that eliminate pathogens to reduce infection loads, leading to resistance, and mechanisms that limit the damage caused by infection without directly targeting the number of pathogens, leading to disease tolerance (Ayres and Schneider, 2012; Medzhitov et al., 2012; Råberg et al., 2009; Vale et al., 2014). While the majority of work on bacterial and viral infections in Drosophila (and most other hosts) has historically focused on mechanisms that eliminate and clear pathogens (Buchon et al., 2014; Obbard et al., 2009; Zambon et al., 2006), the role of mechanisms that limit damage to increase host tolerance is increasingly recognised (Ayres and Schneider, 2012; Medzhitov et al., 2012; Råberg et al., 2009; Soares et al., 2014; Vale et al., 2014). For example recent work has highlighted how tissue damage repair (Jamieson et al., 2013; Soares et al., 2014), immune regulation (Merkling et al., 2015; Sears et al., 2011), and detoxification (Gozzelino et al., 2012; Pamplona et al., 2007) all play a role in enhancing disease tolerance. Variation in disease tolerance is common (Adelman et al., 2013; Howick and Lazzaro, 2014; Råberg et al., 2007; Vale and Little,2012), and may arise from genetic differences in the physiological mechanisms that promote greater tolerance (Råberg et al., 2007), variation in host nutritional states (Howick and Lazzaro, 2014; Sternberg et al., 2012; Vale et al., 2011), and host gut microbiota (Yilmaz et al., 2014). Here we also find evidence for variation in disease tolerance associated with the presence of Wolbachia, and we find that these effects vary according to host sex.
Wolbachia-mediated protection against viral infections, such as Drosophila C Virus (DCV) acts by reducing viral replication (or increasing the host’s ability to clear infection), suggesting that Wolbachia increases resistance against DCV (Hedges et al., 2008; Martinez et al., 2014; Teixeira et al., 2008). In other viral infections, for example Flock House Virus (FHV), flies harbouring Wolbachia appear to become more tolerant to infection, showing increased survival without any change in viral titres (Chrostek et al., 2013; Teixeira et al., 2008). Our results show that Wolbachia affects both resistance and tolerance to P. aeruginosa enteric infection and we found interesting differences between sexes in these responses. Without Wolbachia females were more tolerant than males, while males flies became more tolerant when carrying Wolbachia. While males and females are generally susceptible to the same pathogens, sexual dimorphism in the immune response is apparent in a wide range of species (Duneau and Ebert, 2012; Marriott and Huet-Hudson, 2006; Zuk and McKean, 1996), and is documented for all classes of viral, bacterial, fungal and parasitic infections [see (Cousineau and Alizon,2014) for a review). In invertebrate hosts, and especially in Drosophila, most studies investigating the ability to resist or tolerate bacterial and viral infections have focused primarily on the underlying immune mechanisms (Ayres and Schneider, 2012; Buchon et al., 2014; Kemp and Imler, 2009; Neyen et al., 2014; Schneider et al., 2007), and typically these studies have not focused on sexual differences in these mechanisms [but see (Vincent and Sharp, 2014)). Our results, together with a large body of work on immune sexual dimorphism (Nunn et al., 2009), show that resistance and tolerance mechanisms are likely to vary between males and females.
Evolutionary and epidemiological implications of sex-specific resistance and tolerance
Variation in resistance and tolerance will directly impact the pathogen loads within hosts (Gopinath et al., 2014; Lass et al., 2013; Susi et al., 2015; Vale et al., 2013), and as a result, sexual dimorphism in these responses could generate potentially important heterogeneity in pathogen spread and evolution (Cousineau and Alizon, 2014; Duneau and Ebert, 2012; Gopinath et al., 2014; Vale et al., 2014). Given that Wolbachia are estimated to be highly prevalent in insect populations (Weinert et al., 2015), it is intriguing to consider the potential effects of sexual dimorphism in resistance and tolerance in populations. Theoretical work shows that markedly different evolutionary outcomes for the pathogen are expected when sexual dimorphism in resistance and tolerance is present (Cousineau and Alizon, 2014). One reason is that the mortality rate of males and females will vary due to dimorphism in resistance and tolerance, which in itself will affect the evolutionary trajectories of pathogens (because it will bias infection towards the one sex more than another). Further experimental work is currently needed to test how pathogens are likely to evolve under different host sex ratios, especially when sexual dimorphism in resistance and tolerance is present. Our work suggests that bacterial oral infection in flies benefiting from sex-specific Wolbachia-mediated tolerance would offer a useful model system to address these questions.
Materials And Methods
Fly stocks
Experiments were carried out using long-term lab stocks of Drosophila melanogaster Oregon R (OreR). This line was originally infected with Wolbachia strain wMel, (OreRWol+). To obtain a Wolbachia-free line of the same genetic background (OreRWo-), OreRWol+ flies were cured of Wolbachia by rearing them on cornmeal Lewis medium supplemented with 0.05 mg/ml tetracycline. This treatment was carried out at least 3 years before these experiments were conducted, and the Wolbachia status of both fly lines was verified using PCR with primers specific to Wolbachia surface protein (wsp): forward (5’-3’): GTCCAATAGCTGATGAAGAAAC; reverse (5’-3’):CTGCACCAATAGCGCTATAAA. Both lines were kept as long-term lab stocks on a standard diet of cornmeal Lewis medium, at a constant temperature of 18±1ºC with a 12-hour light/dark cycle. Flies were acclimatised at 25ºC for at least two generations prior to experimental infections.
Bacterial cultures
Infections were carried out using the P. aeruginosa reference strain PA14, which has been shown to have a very broad host range (He et al., 2004; Mikkelsen et al., 2011). To obtain isogenic PA14 cultures, a frozen stock culture was streaked onto fresh LB agar plates and single colonies were inoculated into 50 mL LB broth and incubated overnight at 37 ºC with shaking at 150 rpm. Overnight cultures were diluted 1:100 into 500 mL fresh LB broth and incubated again at 37 ºC with shaking at 150 rpm. At the mid log phase (OD600 = 1.0) we harvested the bacterial cells by centrifugation at 8000 rpm for 10 min, washed the cells twice with 1xPBS and re-suspended the bacterial pellet in 5% sucrose. The final inoculum was adjusted to OD600 = 25, and this was the bacterial inoculum used for all flies inoculated orally (enteric infection).
Enteric and systemic P. aeruginosa infection
For systemic infection, flies were pricked at the pleural suture with a needle dipped in a mid log phase (OD600 = 1.0) PA14 culture, grown as described above. Control flies were pricked with a needle dipped in sterile LB broth. For the oral exposure (enteric infection), the concentrated PA14 inoculum (OD600 = 25) was spotted onto a sterile filter paper (80 μ1/ filter paper), and placed onto a drop of solidified 5% sugar Agar inside the lid of a 7ml Bijou tube. For the uninfected control treatment, filters received the equivalent volume of 5% sucrose solution only. All filter papers were allowed to dry for 20 to 30 minutes at room temperature. We prepared one of these “inoculation lids” for each individual fly. Two to four day-old flies were sex sorted and transferred individually to empty plastic vials: 180 (90 male and 90 female) OreRWol+, and 180 (90 male and 90 female) OreRWol-. Following 2-4 hours of starvation, flies were transferred individually to 7 ml Bijou tubes, and covered with previously prepared “inoculation lids” containing a filter paper soaked in PA14 culture. Flies were left to feed on the bacterial culture for approximately 12 hours at 25 ºC. Following this period, we sacrificed 6 exposed and 2 control flies and counted CFUs by plating the fly homogenate in Pseudomonas isolating media (PAIM). The remaining flies were transferred to vials containing 5% sugar agar and incubated at 25 ºC.
Quantification of within-host bacterial loads
Following the initial 12-hour exposure, every 24 hours we randomly sampled 5 to 7 live flies per sex and Wolbachia status and quantified the microbe loads present inside the flies. Briefly, a single fly was removed from the vial and transferred to 1.5 mL microcentrifuge tubes. To guarantee we were only quantifying CFUs present inside the fly, and not those possibly on its surface, each fly was surface sterilized by adding 75% ethanol for 30-60 seconds (to kill the outer surface bacterial species). Ethanol was discarded and flies were washed twice with distilled water. Plating 100 μL of the 2nd wash in LB agar confirmed this method was efficient in cleaning the surface of the fly (no viable CFUs were detected). Each washed whole fly was placed in 1 mL of 1X PBS in a 1.5-mL screw-top microcentrifuge tube, centrifuged at 5000 rpm for 1 min and the supernatant was discarded. 200 μL of LB broth was then added to each tube and the flies were thoroughly homogenised using a motorised pestle for 1 min. A 100 μL aliquot of homogenate was taken for serial dilution and different dilutions were plated on PAIM agar plates, incubated at 37 ºC for 24 – 48 h and viable CFUs were counted.
Survival assays
We carried out separate experiments to measure how the presence of Wolbachia affected fly mortality during either enteric or systemic infection, with identical fly rearing and bacterial cultural conditions as those described above. For each survival assay (enteric or systemic infection routes), two-to-four day-old flies were sexed and exposed in groups of 10 flies to PA14, as described above. For each combination of male or female OreRWol+ and OreRWol- line, we set up fifty flies, with 10 flies per vial. The flies that died from infection was recorded every approximately every hour until all flies had died (systemic infection), or every 24 hours for up to 8 days (enteric infection).
Statistical analyses of host survival and microbe loads
Fly survival was analysed using a Cox proportional hazards model to compare survival rates, with fly ‘Sex’, ‘Infection status’, and ‘Wolbachia status’ and their interactions as fixed effects. The significance of the effects was assessed using likelihood ratio tests following a χ2distribution. For flies that were exposed orally to DCV, we compared between pairs of treatments (control vs. infected or with and without Wolbachia) using Cox risk ratios.
In orally infected flies, changes in the bacterial load within-hosts were analysed with a linear model with Log CFU as the response variable, and fly ‘Sex’,‘Wolbachia status’, and ‘Time (DPI)’ as fixed effects. Differences in the mean bacterial load of flies immediately following oral exposure (at 12 hours post-infection; Fig S1) were also analysed separately using a linear model with Log CFU as the response variable and ‘Sex’ and ‘Wolbachia status’ as fixed effects. In all models all effects and their interactions were tested in a fully factorial model, and models were simplified by removing non-significant interaction terms. All analyses were conducted in JMP 12 (SAS).
Analysis of disease tolerance
Disease tolerance is defined as the ability to maintain health relative to changes in microbe loads during an infection(Ayres and Schneider, 2012; Medzhitov et al., 2012; Råberg et al., 2009). It is possible to analyse tolerance as the time-ordered health trajectory of a host as microbe loads change (Doeschl-Wilson et al., 2012; Lough et al., 2015; Schneider, 2011). To assess sex‐ and Wolbachia-mediated differences in how sick a fly gets for a given pathogen load (tolerance) during the course of the infection, for each time point we took the survival probability (as a measure host health) and PA14 CFUs present within the flies (as a measure of microbe load) for 5 replicate flies in each sex/Wolbachia combination. While tolerance is commonly described as a linear reaction norm (Lefèvre et al., 2011; Råberg et al., 2007; Simms, 2000), many other functional forms are possible, including non-linear relationships (Vale et al., 2014). To assess the form of the health/microbe relationship, we fit linear and non-linear 4-parameter logistic model separately to the time-matched survival/microbe load plots. In all cases, the 4 parameter logistic model – which is commonly use to asses dose-response curves (Gottschalk and Dunn, 2005) – outperformed the linear fit (Table S1), and we present only the logistic fit in the results section. To test if these tolerance curves differed with Wolbachia status, we tested the parallelism of the models by comparing the error-sums of square for a full model (where each group has different parameters in the logistic model) to a reduced model (where models share all parameters except the inflection point) (Gottschalk and Dunn, 2005).
Gene expression
We used qRT-PCR to test for differences in the expression of genes known to be involved in either bacterial clearance or in the response to stress and gut damage during enteric infection. Previous work has shown that the IMD pathway and some stress response and damage repair genes are especially important during the fly’s response to enteric bacterial pathogens (Buchon et al., 2009). We therefore investigated the expression of IMD pathway receptor genes(pgrp – lc and pgrp – le) and the antimicrobial peptide effector gene attacin A (attA); gstD8, a gene that participates in the detoxification of reactive oxygen species (ROS) produced during microbial immunity in the gut (Ha et al., 2005); gadd45, a gene relevant for epithelial renewal, as it is involved in stress response and wound healing in Drosophila (Stramer et al., 2008; Takekawa and Saito, 1998); and CG32302, a gene identified as up-regulated during enteric bacterial infection(Buchon et al., 2009). CG32302 has been annotated as a putative component of the peritrophic matrix (Buchon et al., 2009), a protective barrier that separates the gut epithelium from the invading bacteria (Lehane, 1997).
Our aim was to test if the expression of these genes varied in a sex‐ or Wolbachia-specific manner in flies that were infected orally. Groups of 5 flies for each sex / Wolbachia combination were exposed orally to P. aeruginosa infection in triplicate, as described above, and then frozen in TRI reagent at 4, 24 and 96 hours post-infection. Total RNA was extracted from flies homogenised in Tri Reagent (Ambion), reverse-transcribed with M-MLV reverse transcriptase (Promega) and random hexamer primers, and then diluted 1:10 with nuclease free water. The qRT-PCR was performed on an Applied Biosystems StepOnePlus system using Fast SYBR Green Master Mix (Applied Biosystems) with the following PCR cycle: 95°C for 2min followed by 40 cycles of 95°C for 10 sec followed by 60°C for 30 sec. Three biological replicates and two qRT-PCR reactions per replicate (technical replicates) were carried out per sample. Gene-specific primers are reported in Table S1. Changes in gene expression were analysed relative to the expression of rp49, an internal control gene. The relative fold-change difference in expression between infected and health control flies was calculated as described in (Livak and Schmittgen, 2001). Briefly: Where, ΔΔCt = [(Ct of Gene A – Ct of Internal control) of Infected sample) – [(Ct of Gene A – Ct of Internal control) of Control sample)
The fold change difference obtained was analysed using 3-way ANOVA with sex (Male, Female), Time (2, 24 and 96 hours) and Wolbachia (Wol‐ and Wol+) as fixed factors.
Funding information
This work was supported by a strategic award from the Wellcome Trust for the Centre for Immunity, Infection and Evolution (http://ciie.bio.ed.ac.uk; grant reference no.
095831), and by a Society in Science – Branco Weiss fellowship (http://www.society-in-science.org), both awarded to P. Vale. P. Vale is also supported by a Chancellor’s fellowship from the School of Biological Sciences
Author contributions
PFV and RBV conceived the study. RBV, GV, JSJ, KMM and PFV conducted experimental work. GV and PFV analysed the data. PFV wrote the manuscript. SPB and PFV contributed reagents and consumables. All authors commented on the manuscript.
Supporting Information
Wolbachia confers sex-specific resistance and tolerance to enteric but not systemic bacterial infection in Drosophila
Radhakrishnan B. Vasanthakrishnan 1,3§,1§, Gupta Vanika 1§, Jonathon Siva-Jothy, Katy M. Monteith1, Sam P. Brown4, Pedro F. Vale1,2*,
S1 file. Materials and methods for feeding assay and PA14 growth inhibition assays.
Feeding assay
All flies used were 0-72 hour old adult Oregon R flies, and Wol‐ and wol+ individuals were raised separately in 6oz bottles on lewis medium at a constant temperature of 25°C on a 12:12 light:dark cycle. Subjects were starved for 2 hours by placing them an empty vial before CO2 anaesthesia was used to separate sexes. While still anaesthetised each fly was placed into an individual 23ml vial containing Blue-dyed Lewis medium (Blue Dye number 1, 0.5g/litre). Between 22-24 individual flies per Sex/Wolbachia combination were set up. All flies were left to feed on the blue dyed medium for 24hours at 25 degrees under 12:12 light:dark cycle. After 24 hours flies were immediately frozen to kill and then decapitated using a scalpel. Decapitation avoids inaccurate absorbance readings due to eye pigments. Each individual fly was then placed in an Eppendorf tube containing 100ul of ice-cold Ringer’s solution, homogenised using a motorised pestle and then centrifuged for 10mins at ~13300g at 20°C. 80 n.l of this supernatant were loaded into a 96-well plate and the blue pigment was measured using a VersaMax microplate reader, recording absorbance at 520nm.
Pseudomonas aeruginosa PA14 inhibition assay
Wol+ and Wol‐ flies were grown in 6 oz plastic bottles on standard Lewis medium under standard laboratory conditions at 25°C, 12:12 Light:Dark cycle. Six days post eclosion, flies were sex separated and divided into cohorts of 10 flies each (n = 10 per sex per line). Flies were anaesthetized using cold anaesthesia. To each sample, 250 μl of LB was added and samples were crushed using an automated pestle and centrifuged at 11,000g for 5 minutes. Supernatant from these samples was used to assay antibacterial response. 100 μl from supernatant was transferred to a well in 96-well plate. PA14 cultures were grown as follows. A single colony was picked from the PA plate and 5 ml of LB medium was inoculated. The culture was grown overnight at 37°C at 200 rpm. 100 μl of the overnight culture was used to seed 5ml of LB. OD was monitored and culture was taken out after it reached OD600 = 1. The OD of the culture was adjusted to 0.02. Each well was seeded with 100 μl of this culture and was mixed well with fly homogenate by pipetting. For controls, LB without any bacteria was used. Bacterial growth in 96-well plate was monitored overnight using Thermo Scientific Varioskan Flash. Plate was incubated at 37°C and readings were collected every half an hour intervals for 16 hours. Data obtained was used to obtain lag phase time, growth rate and saturation time for each well using Growth Curve Analysis Tool (GCAT). These data were analysed using ANOVA with fly sex and Wolbachia status as factors.
We also carried out an inhibition zone assay on PA14 grown on a solid medium. Bacterial cultures and fly homogenate were both prepared as described above. When growing the PA14 culture, 100 μl of a 500-fold dilution was used to plate on LB agar plates to obtain a uniform PA14 lawμ After 30 minutes, 100 μl of fly homogenate was put on the plate. Plates were incubated at 37°C for overnight. Clearance zone formed by fly homogenate was measured using Image J and area values were analysed using ANOVA with fly sex and Wolbachia status as factors.
Acknowledgements
We thank R. Popat for technical assistance, D. Obbard, F. Waldron, T.Little and S. Lewis for helpful discussion and suggestions, and H. Cowan, H. Borthwick for media preparation.