ABTRACT
The transcription factor Suppressor of Hairless and its co-activator, the Notch intracellular domain, are polyglutamine (pQ)-rich factors that target enhancer elements and interact with other locally-bound pQ-rich factors. To understand the functional repertoire of such enhancers, we identify conserved regulatory belts with binding sites for the pQ-rich effectors of both Notch and BMP/Dpp signaling, and the pQ-deficient tissue selectors Apterous (Ap), Scalloped (Sd), and Vestigial (Vg). We find that the densest such binding site cluster in the genome is located in the BMP-inducible nab locus, a homolog of the vertebrate transcriptional co-factors NAB1/NAB2. We report three major findings. First, we find that this nab regulatory belt is a novel enhancer driving dorsal wing margin expression in regions of peak phosphorylated-Mad in wing imaginal discs. Second, we show that Ap is developmentally required to license the nab dorsal wing margin enhancer (DWME) to read-out Notch signaling in the dorsal wing compartment. Third, we find that the nab DWME is embedded in a complex of intronic enhancers, including a wing quadrant enhancer, a proximal wing disc enhancer, and a larval brain enhancer. This enhancer complex coordinates global nab expression via both tissue-specific activation and inter-enhancer silencing. We suggest that DWME integration of BMP signaling maintains nab expression in proliferating margin descendants that have divided away from Notch-Delta boundary signaling. As such, uniform expression of genes like nab and vestigial in proliferating compartments would typically require both boundary and non-boundary lineage-specific enhancers.
Notch signaling is a key animal innovation used to ensure different cell fates in adjacent cells (Artavanis-Tsakonas 1999; Barad et al. 2011; Guruharsha et al. 2012). Cell-cell signaling between membrane-bound Notch receptor and its membrane-bound ligands, Delta and Serrate/Jagged, leads to cleavage and nuclear import of the Notch intracellular domain (NICD) (Schroeter et al. 1998). In the nucleus, NICD binds the transcription factor Suppressor of Hairless, Su(H), to induce or permit activation of target genes via their transcriptional enhancers (Fortini and Artavanis-Tsakonas 1994). This role of Su(H) is further complexified because it can recruit the repressor Hairless in the absence of NICD, further promoting divergent cell fate trajectories (Bang et al. 1995; Barolo et al. 2002; Maier et al. 2011; Ozdemir et al. 2014). This simple operation is central to diverse developmental contexts: (i) tissue compartment boundaries and organizers (signaling across a linear border defining two domains in an epithelium), (ii) proneural clusters (signaling across a circular border encircling a field of cells in an epithelium), (iii) somatic germline niches (signaling between germline stem cells and neighboring somatic cells), (iv) neural stem progenitors and sensory organ precursors (signaling between one cell and surrounding epithelial cells), and (v) asymmetric cell fate lineages (signaling between two dividing daughter cells). For this reason, Notch signaling to a tissue-specific transcriptional enhancer is frequently integrated with different, context-specific, signaling cues throughout development (Voas and Rebay 2004; Ward et al. 2006; Liu and Posakony 2012; Housden et al. 2014).
Notch-target enhancers can be characterized as either Notch instructive or Notch permissive (Bray and Furriols 2001), although other types are also evident (Janody and Treisman 2011). Examples of both instructive and permissive Notch-target enhancers are known for genes expressed in the embryo and imaginal discs of Drosophila. In the early embryo, the E(spl)m8 enhancer is a neurogenic target of an instructive Notch signal (Furukawa et al. 1995; Lecourtois and Schweisguth 1995; Schweisguth 1995). Misexpression of NICD in an ectopic stripe spanning the entire dorsal–ventral (D–V) axis drives over-expression of E(spl)m8 throughout the D–V axis, except in the mesoderm where it is repressed by the C2H2 zinc finger repressor Snail (Cowden and Levine 2002). In contrast, the Notch-target, Su(H)-dependent, sim mesoectodermal enhancer and rhomboid (rho) neurogenic ectoderm enhancer (NEE) are driven ectopically in a way that is limited by the nuclear morphogenic gradient of Dorsal, which also targets these enhancers (Cowden and Levine 2002; Markstein et al. 2004; Crocker et al. 2010). Thus, in the context of the sim and rho enhancers, the Notch signal is only permissive because it is not sufficient for expression.
Wing margin enhancers drive expression along the border separating dorsal and ventral compartments of wing imaginal discs (Jack et al. 1991; Williams et al. 1994; Lecourtois and Schweisguth 1995; Neumann and Cohen 1996b). Wing margin enhancers from E(spl)m8 and cut use Notch signaling instructively, whereas enhancers from vestigial (vg) and wingless (wg) use the signal permissively (Janody and Treisman 2011). Tellingly, these enhancer types respond differently to mutations of genes encoding subunits of the Mediator co-activator complex such as Med12 and Med13, which are required for Notch signaling (Janody and Treisman 2011). In clones deleted for Med12 and Med13, Notch-instructive margin/boundary enhancers from E(spl)m8 and cut fail to drive any expression, while Notch-permissive boundary/margin enhancers from vestigial (vg) and wingless (wg) drive expression that is limited to cells close to the margin. Thus, diverse developmental enhancers encode contextual information specifying whether the Notch signal is sufficient and therefore instructive, or only permissive of activation by other integral patterning signals.
How an enhancer integrates Notch signaling with other signaling pathways in a developmental context is an important question. Some insight comes from studies of the nonhomologous, Notch-permissive NEEs at rho, vn, brk, vnd, and sog (Erives and Levine 2004; Crocker et al. 2008, 2010; Crocker and Erives 2013; Brittain et al. 2014). These enhancers are driven by the Dorsal/Rel morphogenic gradient patterning system of Drosophila. Activation is mediated by a pair of linked binding sites for Dorsal and Twist:Daughterless (Twi:Da) heterodimers, as well as by a separate site for the MADF BESS-domain containing factor Dip3, which is important for SUMOylation of Dorsal and for Dorsal/Twist cooperativity (Bhaskar et al. 2002; Erives and Levine 2004; Ratnaparkhi et al. 2008). Notch input is mediated by a Su(H) binding site as shown by over-expression of constitutively-active NICD and mutation of the Su(H) site (Markstein et al. 2004; Crocker et al. 2010). There are also conserved binding sites for the pioneer factor Zelda (Brittain et al. 2014), which is important for the temporal activity of many embryonic enhancers (Harrison et al. 2011; Nien et al. 2011).
Activator sites for Dorsal, Twi:Da, Dip3, and Su(H) exhibit a constrained organization in each NEE (Erives and Levine 2004). Furthermore, Dorsal gradient readouts by NEEs are sensitive to the length of a spacer element that separates the Dorsal and Twi:Da binding sites (Crocker et al. 2008, 2010; Crocker and Erives 2013), and is exploited in the evolutionary tuning of gradient responses (Crocker et al. 2008, 2010; Brittain et al. 2014). This functional spacer sensitivity of NEEs may involve the poly-glutamine (pQ) enriched trans-activation domains of NEE activators: Dorsal, Twi, Da, Su(H), and Zelda (see Fig. 1A). Additionally, Dorsal:Twi co-activation involves the SUMOylation system (Bhaskar et al. 2002; Ratnaparkhi et al. 2008), which can attenuate pQ-mediated aggregation (Mukherjee et al. 2009). The carboxamide side-chains of both glutamine (Q) and asparagine (N) participate in additional hydrogen bonding, which is a key feature of pQ/pN-mediated protein aggregation. Although proteins with pathological expansions of pQ tracts ≥ 40 residues can self-assemble into cross-β-sheet amyloid fibers (Perutz et al. 2002a,b), proteins with shorter pQ tracts can aggregate into complexes when imported into the nucleus and brought together by a DNA scaffold (Perez et al. 1998). As such, the lengths of functional cis-spacers may modulate the degree of pQ aggregation and/or β-strand interdigitation (Rice et al. 2015).
In D. melanogaster, the NICD co-activator contains a single, long, nearly uninterrupted pQ tract (“Q13HQ17”) that is conformationally variable and functionally important (Wharton et al. 1985; Kelly et al. 2007; Rice et al. 2015). Discovery of the Notch pQ tract led to the study of many such pQ repeats in transcriptional activators, co-activators, and their role in synergistic activation (Wharton et al. 1985; Courey and Tjian 1988; Courey et al. 1989). Su(H)-bound NICD recruits the pQ-rich Mastermind co-activator (Yedvobnick et al. 1988; Newfeld et al. 1993; Helms et al. 1999; Schuldt and Brand 1999; Kovall 2007), as well as pQ-rich Mediator components (Janody and Treisman 2011; Tóth-Petróczy et al. 2008). Thus, Notch-permissive enhancers might function through pQ-aggregated complexes that accumulate in the nucleus. These enhancer-specific complexes might continue forming for the duration that NICD and other pQ-rich signals are being received by these enhancers. To understand the logic and functional repertoire of Notch-permissive enhancers, we seek to identify and study novel Notch target enhancers that also read-out morphogenic signals via pQ-rich effectors.
Here we identify and analyze a novel, Su(H)-dependent, Notch/BMP-integrating enhancer in the BMP-inducible gene nab, which encodes a conserved transcriptional co-factor (Clements et al. 2003; Terriente Félix et al. 2007; Ziv et al. 2009; Hadar et al. 2012). The nab enhancer drives expression in two domains abutting the dorsal wing margin and flanking the stripe of Dpp expression in Drosophila. We find that this dorsal wing margin enhancer (DWME) is licensed by the selector Apterous (Ap) to read-out Notch and BMP/Dpp signaling in the dorsal compartment of wing imaginal discs. Ap is a homeodomain containing factor specifying the dorsal compartment of wing imaginal discs (Cohen et al. 1992; Blair et al. 1994). We show that the activity of the nab DWME, which has multiple Ap-binding sites, is affected by the dosage of Ap, and find that nab is required in the dorsal compartment for morphogenetic patterning of the thorax and wings. We show that activity of the nab DWME is driven by Notch signaling through at least two Su(H) binding sites, and discuss how it likely functions as a lineage-specific enhancer in which BMP effectors maintain DWME activity in off-margin descendants of NICD-positive margin cells. Last, we show that global nab expression is driven by the combined activity of the nab DWME, a wing pouch quadrant enhancer (QE), a proximal wing enhancer (PWE), and a larval brain enhancer (BrE), all of which function as dual enhancers and silencers. Importantly, we find that some of their Su(H) sites function in inter-enhancer silencing, revealing an important hidden aspect of Su(H)-targeted enhancers.
Materials and Methods
Derivation of binding motifs
Derivations of IUPAC DNA motifs from position-weighted matrices from various data sets are illustrated in Fig. S1 (Supporting File S3, also see Table 1). The Mad:Medea binding motif 5′-CNBYGDCGYSNV is a consensus IUPAC motif that we derived from embryonic ChIP-chip data (Bergman et al. 2005) available on JASPAR (Sandelin et al. 2004; Mathelier et al. 2015). The Zelda binding motifs, 5′-CAGGYAR,5′-CAGGTAV, and 5′-YAGGTAR, were based on previously published characterization of Zelda ChIPchip data (Harrison et al. 2011; Nien et al. 2011). The Apterous binding motif 5′-RYTAATKA is a consensus IUPAC motif, which we derived from bacterial 1-hybrid (B1H) data from the FlyFactorSurvey project (Zhu et al. 2011). We also derived the Pangolin (dTcf) binding motif 5′-TTTGWWS from B1H data available from FlyFactorSurvey. For the Scalloped dimer binding motif, which is necessary for recruitment of Vestigial, we re-aligned the known binding sites from the cut, sal, and kni enhancers (Halder and Carroll 2001), and found we could derive the tighter consensus 5′-RVATTNNNNRVATH by using the reverse complement sequences of some sites in a consensus alignment (see Fig. S1 in Supporting File S3). Sequences containing the above sites were identified from the 1344 conserved regulatory belts containing sites matching the Su(H) motif 5′-YGTGRGAAH. Motifs were searched using Regular Expression pattern matching, perl, and grep commands in a UNIX shell environment.
Molecular cloning
DNA fragments were amplified from either genomic DNA extracted from w1118 flies (DNA ⇒ nab-C, and DNA ⇒ nab-A ⇒ nab-Ax), or DNA prepared from the BDGP BAC clone BACR48M07 and its sub-cloned derivatives (BAC ⇒ nab-CDAB ⇒ nab-AB ⇒ nab-B, nab-CDAB ⇒ nab-DAB ⇒ nab-DA, and BAC ⇒ nab-CDA). All enhancer fragments were sequenced in both directions to confirm identity of clones and the absence of unwanted mutations, although the larger fragments were not necessarily sequenced through their entire lengths (see Supporting Files S1 and S2). Su(H) mutations were created using two-step PCR-mediated stitch mutagenesis to introduce changes as indicated in the text, and sequenced to confirm these mutations. Outside of the introduced mutations, the sequences obtained for mutagenized clones are otherwise identical to their parent clones (nab-A, nab-AB, or nab-CDA). To sequence inserts cloned into the pH-Stinger vector we used Stinger-FWD: (5′ATA CCA TTT AGC CGA TCA ATT GTG C) and Stinger-REV: (5′CTG AAC TTG TGG CCG TTT ACG).
Amplified nab intronic fragments were cloned into the Xba I site of the pH-Stinger vector (TATA-box containing hsp70 core promoter driving nuclear eGFP) (Barolo et al. 2004). The nab A fragment was also cloned into the EcoR I site of the “-42 eve-lacZ” pCASPAR vector. The nab intronic fragments were amplified using a high-fidelity Taq polymerase (NEB Platinum Taq mix) and the following oligonucleotide primer pairs designed from the reference iso-1 assembly: nab-A: A-fwd (5′-TGGACGCAACTGGTCTGATA) and A-rev (5′-GACCAAGGATGCGATACGAT); nab-B: B-fwd (5′TTTCAGAAGGGGTTGAACC) and B-rev (5′-CGTATGCATAAGAAACTGGC); nab-C: C-fwd (5′-ACAAGTACAATGGACATGG) and C-rev (5′GAAAAGATACATATGAGTAATGC); nab-Ax: A-fwd and Ax-rev (5′-CCAGCAAGGATTGCCAGG); nab-AB: A-fwd and B-rev; nab-DA: D-fwd (5′-CTCATATGTATCTTTTC, which spans reverse complement of C-rev) and A-rev; nab-DAB: D-fwd and B-rev; nab-CDA: C-fwd and A-rev; and nab-CDAB: C-fwd and B-rev. All primers included flanking restriction sites for Xba I (5′-TCTCAGA) or Bsa I/EcoR I (5′-GGTCTCGAATTC).
Dissection and Antibody Staining
Wandering third instar larvae were dissected and fixed with 11.1% formaldehyde in PBS for 30 minutes. Tissue was washed for 30 minutes in PBT and then blocked with 1% BSA in PBT for 1 hour. Tissue was incubated with primary antibodies over night and with secondary antibodies for 1.5 hours. After each antibody incubation, a series of washes was done for 30 minutes. Nuclear stained tissue was incubated with 17.5µ M DAPI in PBT for 5 minutes, and then washed for 30 minutes. Subsequently the imaginal discs or larval brains were dissected from the remaining tissue and cuticle. This dissection was done on a slide in 80% glycerol. The slide was then covered with a supported cover slip and imaged with a confocal microscope.
The following primary antibodies were used: chicken anti-GFP (1:250) (abcam: ab13070), rabbit anti-Gal4 (1:250) (Santa Cruz Biotechnology: sc-577) mouse anti-Wg (1:25), mouse anti-Ptc (1:50), mouse anti-En (1:50), and mouse anti-βgalactosidase/40-1a (1:12). The last four monoclonal antibody were developed by Cohen, S.M., Guerrero, I., Goodman, C. and Sanes JR. (respectively) and were obtained from the Developmental Studies Hybridoma Bank as concentrates/supernatant and developed under the auspices of the NICHD and maintained by The University of Iowa, Department of Biology, Iowa City, IA 52242. The primary antibodies were detected with Cy2–conjugated Goat anti-Chicken (1:1000) (abcam:ab6960), Cy3-conjucgated Goat anti-Rabbit (1:1000) (abcam:ab6939) or Cy5-conjugated Goat anti-Mouse (1:1000) (Invitrogen:A10525) secondary antibodies.
Drosophila Stocks
Functional analysis of nab and the nab DMWE were performed using stocks obtained from the Bloomington, Kyoto, and VDRC stock centers. The stocks from the Bloomington Stock Center are as follows: N1 (6873), apGal4 (3041), enGal4 UAS:Dcr (25753), UAS:GFP (6874). The nab-RNAi (1607) stock was obtained from the VDRC stock center. The following nab enhancer trap stocks were obtained from the Kyoto Stock Center: nab-NP1316 (112622) and nab-NP3537 (104533).
Notch Mutant Cross
Virgin N1/FM7c flies were crossed with nab DWME (Xchromosome) males. Overnight embryos were collected and sorted by GFP (corresponding to the twist:Gal4 UAS:GFP from the FM7c balancer) at 0, 12, and 24 hours after collection. Sorted embryos grown to wandering third instar were dissected and stained as detailed above.
Data Availability
Transgenic lines carrying all nab enhancer reporters described in this study are available upon request.
Supporting File S1 is a text file containing FASTA sequences for the entire nab-CDAB enhancer complex (reference iso-1 genome) as well as the cloned nab-A sequence. Annotated sequences for the nab-CDAB fragment and the cloned nab-A fragment sequences have been deposited at GenBank under the following accession numbers (TO BE ADDED WHEN RECEIVED). Supporting File S2 is a pdf file showing an annotated alignment of all cloned sequences relative to the reference genome. Supporting File S3 contains four supporting figures as follows. Figure S1 shows our derivation of IUPAC transcription factor motifs that we used in this study. Figure S2 shows images of nab DWME-driven GFP expression in live larvae and pupae and in live dissected imaginal discs. Figure S3 shows overnight beta-gal staining of wing discs dissected from all seven independent P-element lines that we established for the nab-A (DWME) lacZ reporters. Figure S4 shows embryonic fixed nucleosome positions for the nab DWME based on data from (Langley et al. 2014).
Results
Identification of conserved regulatory belts with binding sites for Notch/BMP effectors and wing disc selectors
The Su(H) binding motif (5′-YGTGRGAAH) is remarkably constant across bilaterians and unique to Su(H) (Tun et al. 1994). To identify novel enhancers integrating Notch signaling with pQrich morphogenic effectors akin to the neurogenic ectoderm enhancers (NEEs), we first developed a computational pipeline that identified 1344 evolutionary-conserved regulatory belts containing one or more adjacent Su(H)-binding sites (pipeline and other identified enhancers will be described in a separate manuscript). We find that most regulatory belts range from 15 to 25 peaks of genus-wide conservation. Each peak typically corresponds to one to three overlapping binding sites for transcription factors (TFs). This is consistent with enhancers requiring multiple cis-elements for both nuanced activity patterns and restricted tissue-specificity. Here, we demonstrate how these candidate Su(H)-targeted genetic elements can be used to find model enhancers that are well suited for testing hypotheses about functional enhancer grammar.
To find enhancers that are integrating both Notch and Dpp/BMP signaling, we searched for the subset of 1344 D. melanogaster regulatory belts that also contain a binding site for the pQ/pN-rich Mad:Medea complex, which mediates activation of Dpp/BMP targets (Sekelsky et al. 1995; Newfeld et al. 1996; Wiersdorff et al. 1996; Newfeld et al. 1997; Hudson et al. 1998; Wisotzkey et al. 1998; Campbell and Tomlinson 1999; O’Connor et al. 2006; Weiss et al. 2010). Specifically, we developed and searched for the subset of belts containing the IUPAC consensus motif that we derived for phosphorylated-Mad (p-Mad) ChIPseq peaks (see Material and Methods and Table 1). We also searched for sequences targeted by Zelda, which is a pQ-rich pioneer factor for embryonic enhancers that is also expressed in wing imaginal discs (Staudt et al. 2006; Harrison et al. 2011). Altogether, we found 98 unique regulatory belts containing binding sites for this pQ-rich set of activators Su(H), p-Mad:Medea, and Zelda (Table 1 and Fig. 1).
To find enhancers that are specific to the wing imaginal disc, we refined the subset of 98 down to those that also had binding sites for three wing imaginal disc selectors: (i) Apterous (Ap), which is expressed throughout the dorsal wing compartment (Cohen et al. 1992); and (ii) Scalloped (Sd) and Vestigial (Vg), which are expressed at the dorsal/ventral compartment boundary where there is active Notch-Delta signaling (Halder et al. 1998; Halder and Carroll 2001; Koelzer and Klein 2006). By definition, selectors are TFs that are responsible for a stable binary cell fate decision (García-Bellido 1975; Lawrence et al. 1979; Akam 1998). For Ap, we derived the IUPAC consensus motif 5′-VYTAATKA from its DNA binding profile and found 31/98 regulatory belts with sequences matching this motif (Table 1). For Sd and Vg, we found that 13 of these 31 regulatory belts contain the canonical Sd dimer binding site that recruits the Sd:Sd:Vg complex (Table 1) (Halder and Carroll 2001). All three selectors (Ap, Sd, and Vg) are deficient in pQ/pN tracts unlike the graded signal-dependent effectors (e.g., see Fig. 1), Mediator co-activators subunits, and TBP.
Finally, to focus on pQ-rich graded signal integration of just the Notch and BMP pathways, we set aside 11 of the 13 regulatory belts that had potential binding sites for Tcf/Pangolin. Tcf/Pangolin mediates transcriptional activation in the Wnt and β-catenin/Armadillo signaling pathway (Van de Wetering et al. 1997; Archbold et al. 2014). This last filtering step left us with two regulatory belts at the nab and crossveinless c (cv-c) loci, which are located on the left and right arms of chromosome three, respectively. The gene nab is a BMP-induced transcriptional co-factor involved in embryonic and imaginal disc development (Clements et al. 2003; Terriente Félix et al. 2007; Ziv et al. 2009; Hadar et al. 2012), while the gene cv-c encodes a BMP-induced Rho-type GTPase activating protein (RhoGAP) involved in cross-vein morphogenesis (Matsuda et al. 2013). We later describe how RNAi knock-down of nab phenocopies crossveinless-type wings, suggesting both nab and cv-c function in a common developmental genetic pathway. In this study, we focus on the nab regulatory belt and its interactions with adjacent regulatory elements because it has more sites for each factor than the cv-c regulatory belt (Table 1).
The nab dorsal wing margin enhancer (DWME) drives D/V wing margin expression modulated along the A–P axis
The dense site cluster overlying the nab regulatory belt is located in the long first intron of nab in Drosophila (thick bar underline in Fig. 2A). This same belt is part of a smaller 2.7 kb intronic fragment containing several regulatory belts conserved in both D. melanogaster and D. virilis (see boxed region in Fig. 2A). We cloned the predicted 764 bp “nab-A” fragment and found it corresponds to a dorsal wing margin enhancer (DWME) with augmented expression in regions corresponding to peak p-Mad levels (Fig. 2B–L). (Note: this fragment is 764 bp long in the reference iso-1 genome, but is 762 bp long in the cloned fragment due to polymorphic indels in two separate poly-A tracts.) The nab-A fragment was tested using two different core promoters with different reporter transgenes: (i) a 270 bp minimal hsp70 core promoter-eGFP-nls fusion, and (ii) a 205 bp minimal eve core promoter-lacZ fusion (Fig. 2C). These constructs also tested the nab-A enhancer fragment in both orientations relative to these core promoters (Fig. 2B,C). We generated seven and five independent P-element integrations of the lacZ and eGFP-nls reporter constructs, respectively, and found all twelve to drive the same expression pattern.
We find that the nab-A fragment works equally well across these different reporter constructs in live dissected and undissected discs (Fig. S2 in Supporting File S3), in fixed and double-stained imaginal discs (Fig. 2D–J), in fixed discs stained for β-gal expression (Fig. 2K and Fig. S3 in Supporting File S3), and in fixed discs incubated with an anti-sense lacZ RNA probe (Fig. 2L). In situ hybridization with the same anti-sense lacZ RNA probe also shows that the nab-A fragment drives expression in stage 9/10 long-germ band extended embryos in what may be a subset of embryonic neuroblasts, a known site of nab expression (Clements et al. 2003).
In the wing imaginal disc, the nab DWME drives expression from the D/V border region and into the dorsal compartment by several cells but only in two spots centered in the anterior and posterior compartments, which correspond to regions of peak p-Mad levels. The nab DWME also drives expression in a highly stereotyped pattern that is unique to each compartment. In addition to the thin interrupted row of expression along the D/V margin, expression occurs as an elongated anterior spot and a broader mitten-shaped posterior spot abutting the margin. This robust DWME-driven expression pattern is consistent with our desired goal of finding a wing disc compartment-specific enhancer integrating two orthogonal developmental signals: (i) a dorsal/ventral (D/V) Notch margin signal, and (ii) a graded anterior to posterior (A–P) BMP morphogenic signal. Because endogenous nab is expressed in a broader wing pouch pattern than what we observe for the DWME-driven reporters, below we address how the DWME relates to other possible enhancers at nab. We also address how some of the predicted sites contribute to DWME activity, and how the DWME contributes to Nab function in wing development.
The first intron of nab harbors four separate enhancers
To understand the role of the nab DWME activity in the overall nab expression pattern, we made a series a constructs containing various intronic fragments that we cloned from the first intron of the nab locus (Fig. 3A). These were tested by anti-GFP antibody staining of dissected larval tissues from independent P-element integrated lines as well as pools of these lines (see Materials and Methods). Consistent with the presence of insulators in the pH-Stinger vector, independent lines of the same construct recapitulated each other’s expression patterns.
After comparing a PGawB nab GAL4 enhancer trap line (nabNP1316, insertion site 48 bp upstream, Hayashi et al. (2002)) with the various constructed transgenic reporter lines, we discovered that we identified separate enhancer activities for all known tissues in which nab is expressed (Fig. 4A panels versus B–I panels). The expression pattern of the endogenous nab locus in late third instar wing imaginal discs (Fig. 4A) is driven by a combination of: (i) the DWME activity from the 764 bp nab-A fragment (Fig. 4B), (ii) a quadrant enhancer (QE) activity from a 1.4 kb nab-C fragment (Fig. 4C), and (iii) a proximal wing disc enhancer (PWE) activity from the combined 2.4 kb nab-CDA fragment (triple arrows pointing to dispersed expression pattern in Fig. 4D). The PWE activity, which we also find in both the endogenous enhancer trap line (see triple arrows in Fig. 4A) and a larger 2.7 kb nab-CDAB fragment (Fig. 4E), likely requires elements present in both nab-C and nab-D fragments because neither the nab-C (Fig. 4C) nor the nab-DA fragment (Fig. 4H) recapitulates this pattern on its own.
The robust expression of the endogenous enhancer trap reporter in the dorsal margin of the wing pouch (single horizontal arrow in Fig. 4A) is recapitulated in all reporter lines carrying the nab-A fragment (Fig. 4B and single horizontal arrows in Fig. 4D,E) with one exception summarized in the next section. Furthermore, this dorsal margin activity is absent in the nab-C fragment, which only drives a quadrant pattern in wing imaginal discs (see hollow arrow pointing to gap of expression at margin in Fig. 4C). The combined nab QE+DWME expression pattern, which we see in the nab-CDA and nab-CDAB reporters and the nabNP1316 P{GawB} enhancer trap (Fig. 4A, D, and E), is also recapitulated by a second P{GawB} enhancer trap (nabNP3537, data not shown), which has an insertion site one base pair upstream of nab but in the opposite orientation as nabNP1316, and a third, previously characterized P{GabB} nab enhancer trap line, S149, which has a reported insertion site 23 bp upstream (Gerlitz et al. 2002; Ziv et al. 2009; Hadar et al. 2012).
We also observed that all nab enhancer fragments driving wing pouch expression patterns (DWME and QE) also did so in the haltere imaginal discs (“h” discs in single prime lettered panels of Fig. 4). This suggests to us that nab plays a role in both wing and haltere development that predates evolution of haltere balancing organs from wing discs in dipteran ancestors (Lewis 1978; Weatherbee et al. 1999).
The endogenous enhancer trap reporter is expressed in entire neuronal lineages of the larval brain and in four distinct neurons/cells at the posterior tip of the ventral nerve cord (Fig. 4A″). We find that a 292 bp nab-B fragment, located immediately downstream of nab-A (Fig. 3A), drives the same pattern but at lower levels than the endogenous locus (Fig. 4F″). These lower levels of expression are rescued by larger fragments containing the nab-B region: nab-AB (Fig. 4G″), nab-DAB (Fig. 4H″), or nab-CDAB (Fig. 4E″) fragments. This suggests that the minimalized larval brain enhancer (BrE) present in the nab-B fragment normally functions with additional elements that span into the adjacent nab-A fragment. Nonetheless, a 693 bp truncated nab-A fragment (see nab-Ax fragment in Fig. 3A), which is missing a conserved sequence that is present on the side flanking the nab-B fragment, does not drive any detectable activity in either imaginal discs or larval brain (data not shown). This might signify that the conserved block present in nab-A and separating it from the nab-B fragment is required for both the DWME and BrE activities. Alternatively, BrE boosting elements may be located elsewhere in the nab-A fragment.
The nab enhancers also function as mutual silencers
For each of the four distinct and separable enhancer activities in the first intron of nab, we also find distinct silencer activities (Fig. 3B). For example, while the nab-C fragment does not recapitulate the larval brain enhancer (BrE) activity, it does drive ectopic expression in a more superficial set of larval brain cells, possibly neuroepithelial cells or glia, and some distinct neurons in the ventral nerve cord (Fig. 4C″). This ectopic activity associated with nab-C is not seen from the endogenous locus (Fig. 4A″) or from any fragment that also contains the nab-DA region (Fig. 4D″,E″). This suggests that the ectopic larval brain activity endowed by nab-C is silenced by elements present in nab-DA (Fig. 3B).
In a second example, we find that the nab-AB enhancer is a potent ring enhancer in leg imaginal discs (“l” disc in Fig. 4G′), which is an activity that is not seen for the nab enhancer trap reporter (“l” disc in Fig. 4A′). This activity is attenuated (i.e., made less robust) in the nab-DAB fragment (“l” disc in Fig. 4H′), and is completely silenced in the larger nab-CDAB fragment. This suggests that the ectopic leg disc activity endowed by nab-AB is silenced by elements spanning nab-C and nab-D (Fig. 3B).
In yet a third example, which we previously mentioned as an exception to the presence of DWME activity in all fragments containing nab-A, we find that the nab-AB fragment obliterates dorsal wing margin expression (arrows Fig. 4G). However, this same silencing activity is only able to attenuate the DWME in the context of the larger nab-DAB fragment (Fig. 4H and “w” disc in H′). These results suggest that the nab-B fragment is simultaneously a larval brain enhancer and a dorsal wing margin silencer/attenuator. In a related fourth example, the nab-D fragment also appears to modulate and attenuate nab-A’s DWME activity in the context of the nab-DA fragment (Fig. 4I).
A fifth example of dual enhancer/silencer activity is intertwined with the above third example of the BrE’s wing disc silencing activity. The nab-AB fragment drives ectopic expression in the wing imaginal disc hinge region near the stripe of peak Dpp (Fig. 4G). This activity is attenuated in the nab-DAB fragment (Fig. 4H and “w” disc in H′) and completely silenced in the nab-CDAB fragment (Fig. 4G).
Thus, we find that all of the distinct nab enhancer fragments possess both endogenous (i.e., nab-related) enhancer activities and ectopic enhancer activities. However, these same enhancers also function as inter-enhancer silencers of ectoptic activities and attenuators that modulate their non-ectopic activities. These activities are summarized in Figure 3B. Later, we describe finding that at least one of the intronic Su(H) binding sites involved in inducible activation is also involved in inter-enhancer silencing and attenuation.
Activity of nab DWME requires Notch signaling and Su(H) sites
Single nucleotide transversions to any of the core positions in the invariant Su(H) binding sequence, 5′-YGTGRGAA (core positions underlined), are sufficient to eliminate binding in vitro (Tun et al. 1994). Therefore, to verify that the nab DWME is targeted by Notch signaling via its canonical Su(H) binding sites, we compared DWME activity from nab-A fragments containing either wild type Su(H) sites, a mutated S1 site, or a mutated S2 site (Fig. 5A–E).
The central S1 site is the only sequence within the nab-A fragment that matches the motif 5′-YGTGRGAAH, which we used in our computational screen. We found that the reporter lines with the mutated S1 site (5′-TGTGAGAAT → 5′-TcatAGAAT) lack expression in both wing and haltere discs (Fig. 5B,E). When we mutated the S1 site in the context of the nab-CDA fragment (Fig. 3A), we found diminished expression at the margin similar to the nab-C fragment (compare Fig. 5D to Fig. 4C). Thus, the Su(H) S1 site is absolutely necessary for nab DWME activity in both the cells along the dorsal margin and the anterior/posterior compartment cells located farther into the wing pouch.
The flanking Su(H) S2 site matches the consensus motif 5′-YGTGDGAAH, which is slightly less stringent than the genome screen motif 5′-YGTGRGAAH (Fig. 3A). Nonetheless, this S2 site is still conserved across Drosophila. We found that reporter lines with the mutated S2 site (5′-CGTGTGAAA → 5′-CcatTGAAA) drive diminished expression that is collapsed to two small attenuated spots along the margin near the predicted peak p-Mad regions nab-A (Fig. 5C,E). Thus, the flanking S2 Su(H) site is also important for robust activation along the dorsal wing margin as well as in the off-margin spots.
To confirm that the Su(H) sites work canonically in Notch-dependent inducible activation, we also compared DWME activity from the nab-A-driven reporter in both wild type and mutant Notch backgrounds (Fig. 5F–H). These experiments show that whereas wild type Notch allows robust DWME-activity in nearly 100% of wing imaginal discs, a Notch mutant background (N1) results in about 60% of the discs not having any expression at all and about 40% of the discs having very weak expression close to the margin (Fig. 5F, H). Thus, the nab dorsal wing margin enhancer (DWME) requires both wild type Notch signaling and both of its Su(H) binding sites for robust expression in the wing pouch. This signaling is also required for the off-margin expression in the anterior/posterior compartment “spots” suggesting that BMP input into the DWME is not independent of Notch signaling. These results also suggest that the Su(H) binding sites are not involved in repression in larval stages because mutating them does not uncover ectopic activation.
Su(H) binding sites are involved in inter-enhancer silencing
In the absence of NICD, Su(H) recruits Hairless and establishes a repression complex at many targeted enhancers (Bang et al. 1995; Barolo et al. 2002; Maier et al. 2011). Moreover, there is evidence for long-range looping of multiple Notch/Su(H)-targeted promoters from the E(spl) gene complex into an interaction domain associated with cohesin and the PRC1 polycomb repression complex (Schaaf et al. 2013). We thus hypothesize that some of the predicted Su(H) binding sites involved in Notch-dependent inducible activation might also be involved in inter-enhancer silencing or attenuation.
To test the hypothesis that the S1 Su(H) site within the DWME is responsible for silencing the ectopic larval brain activity associated with nab-C, we mutated this site in the nab-CDA fragment (Fig. 3A). We find that mutation of this site does not result in ectopic expression in larval brains (data not shown). Nonetheless, it is still possible that the S2 site and/or additional lower-affinity sites, which we did not mutate, might participate singly or collectively in an intronic inter-enhancer repression complex featuring Su(H).
To test the hypothesis that the strong S3 Su(H) site present within the BrE is responsible for the silencing of the DWME, we mutated this site (5′-TGTGAGAAC → 5′-TcatAGAAC) in the nab-AB fragment (Fig. 3). Normally, the DWME activity is completely silenced in the wild type nab-AB fragment, and partially attenuated in the nab-DAB fragment. We find that mutation of this S3 Su(H) site in nab-AB rescues the twin spots of DWME activity in about half of the discs (16/30 discs), although at levels much diminished relative to the wild-type nab-A fragment (Fig. arrows 4I). Moreover, we also find that the hinge activity is much expanded along both the A–P axis and along the proximal/distal axis of the imaginal discs (Fig. 4I). This suggests that the S3 Su(H) site is involved in both intra-enhancer repression and inter-enhancer silencing/attenuation.
Apterous licenses the nab DWME to receive Notch/BMP signals in dorsal wing compartment
We hypothesize that there are distinct mechanisms underlying binary selector “licensing” and graded signal readouts. More specifically, we hypothesize that selectors would work through nucleosomal-positioning (see Discussion), while signal pathway effectors would work through pQ-mediated aggregation and Mediator recruitment. To remain agnostic about whether instead activating TFs work through the same mechanism, we will refer to selector activity as (homeotic) licensing and the pathway effector activity as (true) activation for two reasons. First, licensing via the fixation of alternate nucleosome positions could function phenomenologically both in transcriptional activation and in repression depending on whether effector sites are being revealed or occluded with the positional shifting of a fixed nucleosome. Second, signaling pathway-based effectors tend to be pQ-rich like the Mediator co-activator complex (Tóth-Petróczy et al. 2008) and TATA Binding Protein (TBP) (Koide et al. 1999), which are recruited by pathway-effector TFs. Thus, signaling pathway integration via pQ-mediated aggregation would be inherent to eukaryotic activation and functionally-rich.
Based on the above perspective, we used the binding motifs for the pQ-deficient selectors Apterous (Ap) and others to identify the nab DWME. Expression of the selector Apterous (Ap) is restricted to the dorsal compartment of the wing pouch and the proximal parts of the wing imaginal disc (Cohen et al. 1992; Blair et al. 1994) (Fig. 6A). We thus hypothesize that Ap shifts or remodels a default positioned nucleosome that hides the Su(H) site in most tissues and find initial indirect support for this hypothesis in two genomic data sets for the early embryo. First, two different nucleosomal data sets for embryonic stages confirm that there are fixed nucleosomes over the DWME that we predict would obscure its Su(H) sites (Fig. S4 in Supporting File S1 shows positions found for stage 5 embryos) (Mavrich et al. 2008; Langley et al. 2014). Second, embryonic Su(H) ChIP-seq experiments (Nègre et al. 2011) indicate that Su(H) does not bind to the DWME during early embryonic stages, even though it is expressed ubiquitously (Schweisguth and Posakony 1992). Such a model is consistent with both recent support for a more dynamic pattern of Su(H) association with target enhancers (Krejˇcí and Bray 2007) and our nucleosome-based homeotic licensing model. We thus suggest that Ap and other selectors including Sd and Vg, may shift or remodel one or two positioned nucleosomes so as to reveal its Su(H) binding sites and permit Notch inducible activation in the dorsal wing compartment. In this regard, it is notable that Ap binding sequences coincide with nucleosomal entry sequences, which correspond to canonical linker histone H1 binding regions (Syed et al. 2010). In the absence of these selectors, the DWME would be refractive to Notch and possibly Dpp signaling, which are active in many contexts.
To test the hypothesis that the nab DWME is licensed in part by Ap to respond to Notch and BMP developmental signals only in the dorsal wing compartment, we crossed our nab DWME reporter line into backgrounds differing in the dosage of normal Ap. We observed that DWME-driven GFP reporter expression collapses to two stellate clusters of just a few cells along the D/V border region as the levels of normal Ap is reduced. (Fig. 6B–D). This result is more consistent with Ap being required to allow maintenance of DWME activity in off-margin descendants of a few margin cells. However, further studies will be needed to explore this, the order of binding events, and the effects on nucleosome positioning.
Dorsal-compartment expression of nab is required for normal patterning of wing and thorax
Expression of nab in the dorsal compartment of the developing wing pouch is the result of cells using DWME and/or QE activity. To understand better the role of the DWME versus the QE, we used the ap-GAL4 hypomorph (apGAL4) to drive nab RNAi. This likely brings down nab mRNA levels in the dorsal compartment while also specifically disrupting the Ap-dependent activity of the endogenous nab DWME. Thus, in this experiment the most severe disruption of nab expression is expected to be in the DWME-active cells.
Using one copy of the apGAL4 allele to drive expression of UAS:nab-RNAi, we observe a consistent set of phenotypes that include an exaggerated creased wing along the vein II (Fig. 6D). This is often accompanied by a malformed delta-like junction between the first and second wing veins at the anterior margin (Fig. 6E). Sometimes this is accompanied by a disrupted bristle pattern at the juncture of the margin (Fig. 6E vs. 6F wild-type). In addition, the scutellum of these flies is malformed and diminished in size with typically one or more anterior and posterior scutellar bristles missing (compare Fig. 6G,H to Fig. 6I—K). In these flies, the anterior and posterior dorsocentrals in the notum are also frequently absent (Fig. 6I—K). Thus, there are missing or mis-specified macrochaetes in both the notum and scutellum. Wings from apGAL4:nab-RNAi adults show other defects including occasional ectopic wing veins, gaps in the wing vein patterning, and diminished or absent anterior cross-veins (data not shown). Therefore, we propose that normal patterns and/or levels of nab are required in the dorsal margin cells in order to ensure proper wing vein specification and patterning.
The results of dorsal compartment-specific knockdown of nab suggests that expression levels are critical to morphogenetic pattering of the notum and wing veins (Fig. 6). To explore further the importance of nab expression in wing imaginal discs, we expressed nab-RNAi in two additional ways. First, we used an endogenous GAL4-nab enhancer trap line (nab-NP3537) to drive the same nab-RNAi transgene. The prediction is that in this experiment, both endogenous Nab and Gal4 proteins are being synthesized simultaneously as the result of the different regulatory enhancers at Nab inducing transcription of both nab and GAL4. Thus, this experiment might be expected to result in only a partial knockdown of nab protein because of the delayed transcriptional/translational cycle of Gal4-driven nab-RNAi. In this experiment, we observe the mildest effect of all the nab-RNAi experiments in that we only observed one phenotype: frequent loss of the posterior cross-veins but only in adult females (see arrows in Fig. 7 B and C).
To test the role of nab expression in other wing disc compartments, we used an engrailed (en) GAL4 enhancer trap line to drive nab-RNAi in the posterior compartment, which spans both D/V compartments (see Material and Methods). En is a selector protein expressed early in the posterior compartments of wing imaginal discs, where it determines posterior-compartment identity (growth/size, shape, and wing vein patterning) (Lawrence and Morata 1976; Kornberg 1981; Blair 1992; Brower 1986). Importantly, in the en-GAL4 experiment, nab-RNAi would be induced and maintained prior to transcription of nab in early third instar wing imaginal discs (Terriente Félix et al. 2007). To increase the severity of any phenotypes, we used the en-GAL4 transgene to drive both UAS-nab-RNAi and UAS-dicer. This experiment results in a more severe wing vein patterning defect in terms of frequency in both females and males (Fig. 7 D and H, respectively). This phenotype, which includes incomplete and missing longitudinal veins as well as cross-veins, is restricted to the posterior compartment. We do not see any morphological defects in scutellar development, suggesting that ap hypomorphs sensitize scutellar development to loss of Nab function.
In summary, nab-RNAi knockdown experiments demonstrate that nab expression is important in all compartments of wing imaginal discs, including both proximal and distal parts of discs, for the normal developmental patterning of the scutellum, thoracic macrochaetes, and wing veins. This is consistent with nab’s intronic complex of three wing imaginal disc enhancers (QE, PWE, and DWME).
The nab DWME is a lineage specific enhancer maintaining expression in off-margin clonal descendants of margin cells
To better understand the individual roles of the nab-A binding sites mediating Notch and Dpp signaling, we first examined the developmental onset of expression in wing imaginal discs. We find that DWME-driven expression begins around late second/early third instar discs in a few cells at the margin (Fig. 8 A and B). This is consistent with the earliest reported detection of Nab protein in early third instar discs (Terriente Félix et al. 2007). As the discs develop, there are many examples of dividing daughter cells in which one of the daughter cells is dividing away from the D/V boundary while still maintaining equivalent amounts of expression (see circled pairs of cells in Fig. 8A′–D′, and I′). These pairs of dividing cells can also be seen in later stages when descendants are at much farther distances from the margin (Fig. 8I′). We also observe decreasing DWME-driven reporter activity in early to mid third instar cells along the margin when peak p-Mad is presumably still centralized as a single (i.e., non-bimodal) peak (see series of arrows of decreasing size in (Fig. 8I′).
This temporal profile of nab DWME activity suggested to us that the DWME marks a clonal patch of cells descended from a margin cell, which experienced early Notch-Delta signaling (see Fig. 9B and Discussion). This would also explain a role for the Dpp input in stabilizing activity of the DWME in clonal descendants removed from the border of active Notch-Delta signaling. Like clonal fate mapping in wing imaginal discs (Dahmann and Basler 1999), cells expressing DWME-driven GFP are patch-like clusters of dividing cells that respect both D/V and A/P compartment boundaries. Consistent with this idea, DWME-driven patches of GFP expression resemble the D/V-oriented cell proliferation patterns made by marked clones in wing imaginal discs (González-Gaitán et al. 1994). To explore this idea further, we also looked at the nab QE (nab-C) reporter in late third instar/pre-pupal wing imaginal discs specifically to see if the deficiency in dorsal margin expression becomes more noticeable over time. We find that this is possibly the case as the margin gap appears more pronounced than earlier stages (Fig. 8M). This suggests that the nab DWME and QE are complementary lineage-specific enhancers that have evolved to deliver Nab expression in proliferating wing pouch cells more uniformly than what the QE alone could drive.
Discussion
We used a comparative genomics approach to identify and characterize a novel enhancer mediating tissue-compartment specific activation based on the integration of two signaling pathways: Notch and BMP/Dpp. This approach led us to a dense intronic cluster of binding sites for the desired activators and selectors at the Drosophila gene nab. “Nab” was named for “NGFI-A binding” and is present in vertebrates as Nab1 and Nab2, where they work as co-repressors of Egr-1 (NGFI-A) and Krox20 to control proliferation, patterning, and differentiation (Russo et al. 1995; Svaren et al. 1996). Similarly in the nematode C. elegans, this gene encodes MAB-10/NAB, which is a co-repressor of LIN29/EGR and is involved in cellular differentiation (Harris and Horvitz 2011). In Drosophila, LIN-29/EGR functions appear to be maintained across three paralogous genes rotund (rn), squeeze, and lin19 (Vilella et al. 2009). Correspondingly, Drosophila Nab functions as a co-repressor of Rn in wing imaginal discs and as a co-activator of Squeeze in a subset of embryonic neuroblasts (Terriente Félix et al. 2007). Thus, nab is conserved across bilaterian animals and encodes a co-factor of a subfamily of C2H2 zinc finger transcription factors involved in developmental patterning and differentiation.
The dense site cluster that we identified in the first intron of nab drives a novel expression pattern that is consistent with integration of a D/V Notch signal and an orthogonal A–P BMP signal. The nab locus is already known to be induced by Dpp/BMP signaling (Ziv et al. 2009; Hadar et al. 2012). This is consistent with our finding several canonical Mad:Medea binding sequences in the nab DWME (Fig. 3A) and several low-affinity Mad:Medea binding sequences in the nab QE (not shown). Furthermore, both the DWME and QE drive A–P modulated expression in the wing pouch (Fig. 4B, C, B′″, and C′″). Here, we investigated the role of Notch signaling as one input integrated by the nab DWME. We find that the nab DWME has at least two canonical Su(H) binding sites that are critical to its activity at the D/V margin. This activity is also impacted by a mutant Notch background. Thus, this may be the first example of a wing disc enhancer that is downstream of both Notch and BMP signaling. Furthermore, by virtue of its obligate Notch signaling input, the DWME’s transcriptional readout of the BMP morphogen gradient is an idealized two-dimensional graph of p-Mad levels (y-axis) at different A–P positions (x-axis).
To deconstruct the developmental role of nab expression in different wing compartments, we used the ap-GAL4 enhancer trap to drive nab-RNAi in the dorsal compartment. This RNAi experiment would also knockdown activity of the Ap-dependent dorsal wing margin enhancer in the dorsal wing compartment. With this manipulation, we observed morphogenetic defects of both the thorax and the wing, suggesting an important role for Nab in developmental patterning of the dorsal compartment. More specifically, the patterning defects affect the scutellum and thoracic macrochaetes, consistent with both nab expression and its proximal wing imaginal disc enhancer (PWE). This experiment also resulted in an increased rate of wing vein patterning defects. We also observed similar wing vein patterning defects, including loss of the posterior cross-vein in males and females and loss of longitudinal veins IV and V in males, when we drove UAS:nab-RNAi in the posterior compartment using an en-GAL4 enhancer trap line. A milder knockdown using a nab-GAL4 enhancer trap line resulted in an increased loss of the posterior cross-vein in adult females. Thus, of all the phenotypes, developmental specification of the posterior cross-vein was the most sensitive to diminished Nab function. This is a significant finding given that crossveinless c was the only other locus in the genome having a similar cluster of binding sites as the nab DWME (Table 1).
Lineage-specific aspects of wing margin and wing quadrant enhancers
Inspection of the site composition of the nab DWME shows it is a lot like the wing margin enhancer (WME) at cut (Fig. 9A). Both wing margin enhancers are induced by Notch signaling and have functional sites for Su(H) (Jack et al. 1991; Neumann and Cohen 1996a). We find both enhancers also have sequences matching the binding preferences for Zelda and Scalloped dimer dimers sites, although the cut WME has many more of the latter. However, the nab and cut wing margin enhancers each have multiple binding sites either for Mad:Medea or for Tcf, but not for both (compare purple SMAD sites in the nab DWME versus green Tcf sites in the cut WME in Fig. 9A). Unlike the Mad:Medea complex, Drosophila Tcf/Pangolin and its β-catenin co-activator Armadillo, which together mediate Wg/WNT signaling, are not pQ/pN-rich. We thus propose the following model for pQmediated Notch/BMP signal integration at the nab DWME (Fig. 9B) that distinguishes it from the cut WME (Fig. 9C).
We hypothesize that pQ/pN-mediated aggregation of Mad:Medea and Su(H):NICD complexes produced by the nab DWME stabilizes and maintains an active DWME in off-margin clonal descendants of D/V margin cells. Thus, the nab DWME would remain active only in daughter cells that are also simultaneously experiencing high levels of nuclear p-Mad (see arrows in Fig. 9B). In contrast, the cut WME would become inactive in these same off-margin daughter cells because they are no longer experiencing Notch or Wg signaling (see arrows in Fig. 9C). In this way, the nab DWME functions as a lineage-specific enhancer in regions with active phosphorylated-Mad (p-Mad). In contrast, the cut WME is not lineage-specific because its activity is extinguished in cell descendants as they divide away from the margin. Consistent with this model of Notch/BMP integration at the nab DWME, the presumed p-Mad input is not sufficient for driving DWME expression in cells that although having peak p-Mad levels are not descended from margin cells.
The cut locus is not expressed throughout the wing pouch like the nab and vg genes, both of which have separate margin/boundary and quadrant enhancers. This also highlights the lineage-specificity of some wing pouch enhancers as follows. The vg locus contains a Notch-target boundary enhancer (Williams et al. 1994) as well as a separate BMP-target quadrant enhancer (Kim et al. 1997). The vg boundary enhancer drives expression broadly throughout the presumptive wing border region while the nab DWME drives expression in a dorsal margin cells and their off-margin descendants. While the vg locus has separate “single-channel” enhancers responsive to either Notch or BMP signaling pathways, the nab locus has enhancers responsive to combined Notch/BMP signals and (presumably) BMP-only signals. Nonetheless, separate margin/boundary and quadrant enhancers would be required by loci expressed uniformly in proliferating cells of the developing wing pouch. Potentially, this “rule” might generalize across diverse developmental systems in which a gene is expressed broadly in a proliferating tissue patterned by a smaller number of compartment organizer cells. One enhancer would respond to signals experienced specifically by organizer cells, and a second enhancer would respond to signals experienced more broadly across the developmental field.
Our study of the nab intronic enhancer complex also demonstrates a remarkable aspect of transcriptional enhancers. We found that all of the nab intronic enhancers are also silencers. We discovered this because we were monitoring expression across several tissues of the embryo, larva, and pupa. This suggests that we should be cautious about the effects of enhancer (“over”)minimalization. This hidden aspect of enhancers may predispose tissue-specific enhancer screens to high false-positive rates of detection if short regulatory DNA fragments are associated with ectopic activities. In any case, these results suggest a new role for Su(H) in mediating inter-enhancer silencing and attenuation. This functional role is worth testing in greater depth across several additional examples.
Selectors: Licensing Factors via Nucleosomal Positioning?
Homeotic selectors were defined initially as TFs that decide and maintain a choice of alternate cell fate potentials for a clonal population of cells and their descendants (García-Bellido 1975; Lawrence et al. 1979). One early clue suggesting that they correspond to a specific regulatory mechanism was that (homeotic) selectors in animals were predominantly found in the form of homeodomain-containing factors (McGinnis et al. 1984). While selectors were initially discussed in terms of cell fate determination and cell fate potential, a consideration of evolutionary processes suggested an emphasis on the role of transcriptional enhancers as important components of selector-based regulation (Akam 1998). Thus, we hypothesize that the phenomenology of selectors acting on cell fate decisions lies in their roles as factors licensing enhancer DNAs to receive graded developmental signals through any number of pathways (e.g., Notch, BMP/Dpp, WNT/Wg, and Hh).
The nab DWME, nab QE, cut WME, and vg WME (i.e., the boundary enhancer, BE) have binding sites for homeotic selectors in addition to those for the pathway-mediating effectors. Selectors can act in a negative or positive manner as demonstrated by known wing disc enhancers. The vg WME uniquely has matching sites for the posterior Hox factor Abd-B homeotic selector (5′-YYTTTATGK) that are not found in either the nab or cut WMEs (data not shown). Abd-B plays a negative selector role by prohibiting expression of vg in posterior segments (Carroll et al. 1995). Similarly, the nab QE possesses binding sites for Homothorax (Hth) (5′-ARYDATSRC), which is known to ChIP to this enhancer (Slattery et al. 2013). Hth is expressed throughout the disc except in the wing pouch and is thus likely to prohibit expression outside of the wing pouch. This would be consistent with the clean border of nab QE reporter expression at the wing pouch/hinge border. In contrast, Hth sites are absent in the vg WME, which drives D/V margin expression beyond the pouch.
The wing margin enhancers at nab and cut are likely to use positively acting selectors. Consistent with the site composition of the nab and cut WMEs (Fig. 9A), the former would be positively licensed primarily by the selector Ap for the dorsal wing compartment (see cells without X’s in Fig. 9B), while the latter would be positively licensed by the selector complex of Sd and Vg (see cells without X’s in Fig. 9C). Thus, a reduction of the dosage of Ap causes DWME-driven expression to collapse to a few cells along the wing margin. Because of the dorsal compartment-specific expression of Ap, and the known localization of activity of Notch signaling to the margin, it is the Notch pathway, secondarily augmented by the BMP input, that drives its expression pattern. Ap only marks a larger domain in which DWME activity can occur. Thus, we interpret this as Ap “licensing” the Notch-dependent DWME for expression exclusively in the dorsal compartment. Additional positively-acting selectors are likely to work at the nab DWME based on conservation of known binding sequences, but further work will be required to elucidate these more definitively. In addition to the cluster of Ap binding sites, and a single Sd:Sd:Vg site, we also find a binding site for the homeotic selector Dll (5′-ATAATYAT), which has a similar expression pattern to Sd and Vg at the wing margin (Campbell and Tomlinson 1998), but this site is not as distinct as the Sd dimer sites. We thus suspect that the DWME might be licensed collectively by Sd, Vg, Dll, and Ap.
We speculate on how the selector licensing class might function to permit and restrict enhancer activities based on certain sequence features in the nab DWME. These features hint at the role of selectors in making the enhancer sequences either receptive or refractory to effector DNA binding via fixed or remodeled nucleosomal positions. The core sequence of the DWME possesses contains fixed nucleosomal positions in early embryonic stages prior to DWME activity (Fig. S4 in Supporting File S3) (Mavrich et al. 2008; Langley et al. 2012). At specific sites flanking these fixed nucleosomes, there are also polyT, homopolymeric runs (Fig. S4), which can act as nucleosome repulsing sequences (Anderson and Widom 2001; Segal and Widom 2009). In addition, we also see evidence for competing TT/AA/TA dinucleotide phasing embedded at these fixed nucleosomal windows (Lowary and Widom 1998; Thåström et al. 1999; Segal et al. 2006). Based on the known Su(H) binding structures (Arnett et al. 2010), these fixed positions would make the central S1 Su(H) site unavailable for binding (Fig. S4). We thus suggest that some selectors may act by simply binding and stabilizing alternate nucleosomal positions that reveal effector binding sites. Intriguingly, we also find that Apterous binding sites coincide with the nucleosomal DNA entry regions that are also associated with the repressor linker histone H1 (Syed et al. 2010). Consistent with the inability of Su(H) to bind the DWME sites in the absence of Ap, we find that Su(H) ChIP signals at the nab DWME have not been detected in embryonic stages (Nègre et al. 2011).
We speculate that the above homeodomain-containing selectors (Ap, Dll, Hth) and other selectors (e.g., Sd and Vg) work via a mechanism that is different from the graded spatial (Notch/BMP) and temporal (Zld) patterning effectors. The above set of selectors are deficient in pQ (Fig. 1A), pN (Fig. 1B), and mixed p(Q/N) carboxamide (Fig. 1C) tracts unlike the spatiotemporal effectors and the Mediator co-activator complex, which they recruit in their role as activators. We suggest that the phenomenon of graded signal integration by effectors also occurs via generic poly-carboxamide aggregation as dictated by the composition of binding sites present in different DNA enhancer scaffolds. In stark contrast, pQ/pN-deficient selectors could bind and fix (i.e., stabilize) default or alternate nucleosomal positions without cross-interacting with pQ/pN-rich effectors. Furthermore, the relationship between selector and pathway effector binding sites would be informed by a helically-phased “regulatory reading frame” based on nucleosomal positioning.
Acknowledgments
This work was supported in part by an NSF CAREER award to AE to study morphogen gradient enhancer readouts (IOS:1239673), an NIH T-32 bioinformatics training grant support to ES, and two Evelyn Hart Watson research fellowships (2014 and 2015) to ES. We thank Timothy Fuqua for assistance with some of the antibody staining protocols. We thank Timothy Fuqua for comments on an earlier version of this manuscript.
Footnotes
↵1 Department of Biology, University of Iowa, Iowa City, IA, 52242-1324, USA. E-mail: albert-erives{at}uiowa.edu